Transcript

selenoh-202

ID
ZDB-TSCRIPT-090929-23086
Name
selenoh-202
Previous Names
  • seph-001
Transcript Type
mRNA
Annotation Status
fragmented
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030374 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030374|OTTDARG00000023334|ZDB-GENE-030411-2 seph|OTTDARP00000024755 seph-001 LG_ BX469901.13 Danio rerio protein_coding KNOWN, 867 bp
TGCTTTAAAAAAATACAATTTGATGGCTAATTTAATAAAA
CCAGGTGTAATTACTGTTTTACATTAATGTGAGTGTTGGG
GGGTAAACGTTAATAAGGTACAATCGATGTGTGATTTAAT
AATTCAATAATTCTCGTTAACTTCCGACTGCAACTGTATC
CCTTCCAGCAATCCCCGCGAAAAACTTCTCACGTGTGTTG
TTGCTGCTGCAATGGCGACTCGAGGCAAGTCAGCTCGCAA
GCGAAAGGCGGATTCAGACGAAAAAGAAAAGCTTGACGAT
GCCAAGAAAGAAAAGCTTGAGGATAAGGATGAAGAAACAG
GACTGAGGGTGGTCATCGAGCATTGTAAGAGCTGACGGGT
TTACGGGCGCAACGCGGTCGTCGTGCGGGAAGCTCTTGCA
GATTCGCACCCTGAACTCAAAGTGATGATAAACCCGCACA
ATCCCCGGAGAAACAGCTTTGAAATCACGCTGATGGACGG
AGAAAGAGCGGATGTTTTGTGGTCCGGCATTAAAAAGGGT
CCTCCACGCAAACTCAAGTTCCCTGAGCCTGCTGAAGTGG
TGACCGCCCTGAAACAAGCGCTGGAGAAAGAGTAAATACT
GTCTGCTTTCTGTGCTCCTGGACACTGGATGCATTTATGA
TGTGAATGGACTAATGGGAAAATCTCCCCGTCTGTTTACT
GATGACCGACTCTGCTGTTCTGGACTGGAATGCTGACTTT
GCCTCGTTTCCTCTGTTAACCATTGTTCAGTTCTGCTGTC
ACATGATTAGTGTTAATTTGCCTTTATATGTCTTGTGTCT
AGTGTTTGTGTCATTCACCTTTTAACTGTTTGAATGGCAC
AAATAAAGCAACTATTTCTTGACAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations