Transcript

selenoh-201

ID
ZDB-TSCRIPT-090929-12597
Name
selenoh-201
Previous Names
  • seph-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030375 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030375|OTTDARG00000023334|ZDB-GENE-030411-2 seph|OTTDARP00000024756 seph-002 LG_ BX469901.13 Danio rerio protein_coding KNOWN, 1335 bp
GGCAATGCACCTAAAAGTTGTATACAAACCACCAATAAAA
CTCATGGGGAAAAAGAAGAAGAAGAGAGCGCAGTTTGAAA
TTTTGCACGGCGGGGTACTCAAAAACGACAACATCTTGTA
CATCTGATCTGACATTCCGTGGACATGCCTCGCCATACAT
CGGCACACAAGCGAAAGCCATCGACGCCCAGACGCAGATC
TCCCCCTGCATCACTACCACCGCCGGCAGGGTCAAGAACC
CGCCGCCACAGCGGACCATCCGGATCATCGCCGCGCAAGA
AACACAAATTTCGCCCTGGCACCCGAGCACTCATGGAGAT
ACGCAAGTATCAGAAGTCGACCGGTCTTCTGCTGCGCAAG
GCTCCGTTTTCACGACTGGTGCGGGAGGTGTGTCAGATGT
TCAGCCGAGAGCACATGATGTGGCAAGGATATGCTTTAAT
GGCTCTACAGGAGGCTGCAGAGGCGTTCATGGTTCGTCTG
TTTTCTGATGCCAACCTCTGTGCCATTCACGCCAAGAGAG
TGACGTTGTTCCCACGTGACATACAACTCGCCCGGAGGAT
CAGAGGCGTTGAACACATGTAAAACTGCATGTCAGGATTC
AATCAATTCCTTTCAGTCTTGCTGATCAATCCCCGCGAAA
AACTTCTCACGTGTGTTGTTGCTGCTGCAATGGCGACTCG
AGGCAAGTCAGCTCGCAAGCGAAAGGCGGATTCAGACGAA
AAAGAAAAGCTTGACGATGCCAAGAAAGAAAAGCTTGAGG
ATAAGGATGAAGAAACAGGACTGAGGGTGGTCATCGAGCA
TTGTAAGAGCTGACGGGTTTACGGGCGCAACGCGGTCGTC
GTGCGGGAAGCTCTTGCAGATTCGCACCCTGAACTCAAAG
TGATGATAAACCCGCACAATCCCCGGAGAAACAGCTTTGA
AATCACGCTGATGGACGGAGAAAGAGCGGATGTTTTGTGG
TCCGGCATTAAAAAGGGTCCTCCACGCAAACTCAAGTTCC
CTGAGCCTGCTGAAGTGGTGACCGCCCTGAAACAAGCGCT
GGAGAAAGAGTAAATACTGTCTGCTTTCTGTGCTCCTGGA
CACTGGATGCATTTATGATGTGAATGGACTAATGGGAAAA
TCTCCCCGTCTGTTTACTGATGACCGACTCTGCTGTTCTG
GACTGGAATGCTGACTTTGCCTCGTTTCCTCTGTTAACCA
TTGTTCAGTTCTGCTGTCACATGATTAGTGTTAATTTGCC
TTTATATGTCTTGTGTCTAGTGTTTGTGTCATTCACCTTT
TAACTGTTTGAATGGCACAAATAAAGCAACTATTTCTTGA
CAAAAGGCTGACTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations