header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-23076
Transcript Name: hbbe1.2-201
Previous Names: hbbe1.2-001, ottdart00000025419, zfinnucl0000004554

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025419 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025419|OTTDARG00000020355|ZDB-GENE-090501-3 hbbe1.2|OTTDARP00000020914 CH211-5K11.4-001 LG_ AL935210.8 Danio rerio protein_coding NOVEL, 583 bp
ACAGCACTCTTCAGCTTCTGTTTAAGACACTTAGTCTGAA
CATCTAAAGTCGAAAACATGGTTGTGTGGACAGACTTCGA
GAAGGCCACCATTCAAGATATCTTCGCCAAGGCTGACTAC
GACGTCATCGGTCCTCAGGCTCTGGCAAGGTGTCTTATCG
TGTACCCCTGGACCCAGCGGTACTTCGCCAAGTTTGGAAA
CCTCTACAATGCCGCTGCCATCCTGGGAAACCCAATGGTT
GCTGCCCACGGTAAAACTGTGCTCAAGGGTCTGGAGCTGG
CTGTAAAGAACATGGACAACATCAAGGCCACCTATGCTGA
TTTAAGTGTGCTGCACTCCGAGAAGCTCCACGTAGATCCC
GACAACTTCAGGCTTTTGGCTGATTGCTTGACCATCGTTG
TTGCTGCTCAGATGGGTGCTGGATTCACACCTGAAGTTCA
GGCCGCTTTCCAGAAATTCATCGCTGTTGCGGTGTCCGCT
CTGGGAAGACAGTACCACTAAATACAGACAGAGAGAGATT
ATAATGTTTCCACTAAAGAATGTGCTATTCTGAGTTGAAG
CAAATAAATATTTCACTATTCAA

hbbe1.2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA hbbe1.2-003 (1) 567
mRNA hbbe1.2-201 583
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hbbe1.2-201 Contained in:

OTHER hbbe1.2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025419 (1)
  • Ensembl_Trans:ENSDART00000128380 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK668066 (1) 677bp
    GenBank:CK673331 (1) 668bp
    GenBank:AF082662 (1) 590bp
    GenBank:AY325265 (1) 445bp
    CITATIONS (2)