header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-1596
Transcript Name: hbbe1.2-003
Previous Name: ch211-5k11.4-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060093 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060093|OTTDARG00000020355|ZDB-GENE-090501-3 hbbe1.2|no_translation CH211-5K11.4-003 LG_ AL935210.8 Danio rerio protein_coding NOVEL, 567 bp
ACAGCACTCTTCAGCTTCTGTTTAAGACACTTAGTCTGAA
CATCTAAAGTCGAAAACATGGTTGTGTGGACAGACTTCGA
GAAGGCCACCATTCAAGATATCTTCGCCAAGGCTGACTAC
GACGTCATCGGTCCTCAGGCTCTGGCAAGGTAATGAGTCT
TGGAGCTTATATTAACTTATATTTATAACATTACATAAGG
CAGGAGACTGGTTTCGAGACAGCTGCTCTAATAAAATTTG
TTTTCATCAGGTGTCTTATCGTGTACCCCTGGACCCAGCG
GTACTTCGCCAAGTTTGGAAACCTCTACAATGCCGCTGCC
ATCCTGGGAAACCCAATGGTTGCTGCCCACGGTAAAACTG
TGCTCAAGGGTCTGGAGCTGGCTGTAAAGAACATGGACAA
CATCAAGGCCACCTATGCTGATTTAAGTGTGCTGCACTCC
GAGAAGCTCCACGTAGATCCCGACAACTTCAGGCTTTTGG
CTGATTGCTTGACCATCGTTGTTGCTGCTCAGATGGGTGC
TGGATTCACACCTGAAGTTCAGGCCGCTTTCCAGAAATTC
ATCGCTG

hbbe1.2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA hbbe1.2-003 567
mRNA hbbe1.2-201 (1) 583
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hbbe1.2-003 Contained in:

OTHER hbbe1.2-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000060093 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CB359334 (1) 571bp
    CITATIONS (1)