Transcript

ednrba-001

ID
ZDB-TSCRIPT-090929-22964
Name
ednrba-001
Previous Names
  • ednrb1-001
  • ednrb1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002398 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002398|OTTDARG00000002222|ZDB-GENE-980526-16 ednrba|OTTDARP00000002125 ednrb1-001 LG_ AL606722.18 Danio rerio protein_coding KNOWN, 1492 bp
AACCATGCATAGAAAACTATTGCAATAGGTTTATTAATGA
TTTTGTAATTCTAGCCTACAGACGGGTTGATATCTGTGTT
ATGCTAAAGAAAACAGTGCTGACTGTTAAATAGTCATGCG
TTTCCAAATTATTATGGAAACAAGATGCGTTTTTTGTTTT
TTGTTTCTCCTGACTGAACACATTGCAGTGATGAGTGCTC
AAGGAAAGGATTTTAATCAGAGTCGGCTTTCCATGGGACC
TTTGTCTCCAACTCAAAAATCTACGATTGTAATAGGAAAC
CAGATCAACGAGTCCATGCCTCGGCGACCAAAAGTTTTGC
CTCCTATGTGTACAGATCCCACGGAAATCAGGGACACCTT
CAAGTATATTAACACCGTGGTTTCATGCCTTGTATTTGTA
GTTGGTATAATCGGAAATTCCACGCTGCTTAGAATCATTT
ATAAAAACAAATGCATGCGGAACGGTCCAAATATTCTCAT
TGCAAGTCTGGCGCTTGGGGACCTCTTACACATCATGATA
GACATTCCCATCAATGTGTATAAGCTTCTGGCTAAAGATT
GGCCATTTGGTGTTGGACTTTGCAAACTGGTTCCTTTTAT
ACAAAAGACATCAGTTGGCATTACAATTCTGAGTTTGTGT
GCACTGAGCATAGACAGATTTCGAGCAGTGTCATCCTGGA
ACCGCATCAAAGGCATTGGTGTTCCCAAATGGACAGCCAT
TGAAATCATTCTGATTTGGGTGTTGTCCATTATACTTGCA
GTGCCAGAGGCCATTGCCTTTGACATGATCACAATGGACT
ACAAAGGAGAGCAGCTCAGGATTTGCCTTCTGCACCCTAA
GCAAAGAATCAAGTTTATGCAGTTTTATAAGAAAGCCAAA
GATTGGTGGCTTTTCAGCTTCTACTTCTGCATGCCATTGA
CATGTACTGCCATATTTTACACTCTTATGACCTGTGAAAT
GCTTCGGAAAAAAAATGGAGTCCAAATTGCACTCAGTGAT
CACATAAAACAGAGACGTGAGGTGGCTAAAACCGTTTTCT
GTTTGGTGCTAGTCTTTGCACTGTGCTGGCTTCCACTGCA
TCTTAGTCGTATTCTTCAACGTACAATTTATGATGAAAGG
GACCCCAACCGTTGTGAGCTTCTGAGTTTCTTCTTGGTTC
TTGATTATATTGGGATCAATATGGCATCAGTGAACTCATG
TATAAACCCAATTGCTTTGTACATGGTTAGCAAGCGCTTC
AAGAGCTGCTTCAGATCATGTCTGTGTTGCTGGTGTCTGC
CTCCTGAAATACTAGCCATGGATGACAAACAGTCCTGCAT
AAAGCTGAAGGTAACAGAGCGAGGATCAGCCATAACAGCC
ATGTCTCCAACAAGTATACTTCAAATTAGGCACTGATATG
CTTACATGTATCAATGGCCAACAAATTTACTTTAACATTT
AATACTATGCAAATAAAACCATGAACCATAAAATGGTGAT
ATAAAAGGCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations