Transcript

ottdart00000001843

ID
ZDB-TSCRIPT-090929-22927
Name
ottdart00000001843
Previous Names
  • busm1-79f24.4-001
  • si:busm1-79f24.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001843 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001843|OTTDARG00000001725|ZDB-GENE-030616-542 ebpl|OTTDARP00000001628 BUSM1-79F24.4-001 LG_ AL606727.3 Danio rerio protein_coding NOVEL, 401 bp
ATGGCAGAATTCGACCAACAGCATGATGAACCTGCACTCT
TCACTAAAGTAACTGTTTATTCTCTGCTCGCCTGTGTGGC
TCAGTTTGCTGTCGGCTTTGCCTTCGCTCAAAAATGGGGC
CATAAATGTTCAGCGGTTGACCGGTGGGTCCTCGTGTGGT
TATTTTACGACGCAATAGTTCATTTTACTCTGGAAGGACC
ATTCGTCTACATGTCGCTTGTTGGAAATGTGGCGTCCTCA
GACAACCTGCTGGCAGAGTTATGGAAAGAATATGGCAAGG
CAGATGAGCGATGGCTATATTCAGACCCGACTATCGTTTC
TCTAGAGCTTCTGACTGTGGTTTTAGACGGTTCATTGGCC
CTACTTCTGGTCTACGCCATCATTAAAGACAAACACTACA
G

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations