ZFIN ID: ZDB-TSCRIPT-090929-22927
Transcript Name: ottdart00000001843
Previous Names: busm1-79f24.4-001, si:busm1-79f24.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001843 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001843|OTTDARG00000001725|ZDB-GENE-030616-542 ebpl|OTTDARP00000001628 BUSM1-79F24.4-001 LG_ AL606727.3 Danio rerio protein_coding NOVEL, 401 bp
ATGGCAGAATTCGACCAACAGCATGATGAACCTGCACTCT
TCACTAAAGTAACTGTTTATTCTCTGCTCGCCTGTGTGGC
TCAGTTTGCTGTCGGCTTTGCCTTCGCTCAAAAATGGGGC
CATAAATGTTCAGCGGTTGACCGGTGGGTCCTCGTGTGGT
TATTTTACGACGCAATAGTTCATTTTACTCTGGAAGGACC
ATTCGTCTACATGTCGCTTGTTGGAAATGTGGCGTCCTCA
GACAACCTGCTGGCAGAGTTATGGAAAGAATATGGCAAGG
CAGATGAGCGATGGCTATATTCAGACCCGACTATCGTTTC
TCTAGAGCTTCTGACTGTGGTTTTAGACGGTTCATTGGCC
CTACTTCTGGTCTACGCCATCATTAAAGACAAACACTACA
G

ebpl TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ebpl-201 (1)    Ensembl 967
ottdart00000001843 401
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000001843 Contained in:
[PAC] BUSM1-79F24 (1)

Genome Resources: Vega_Trans:OTTDART00000001843 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)