Transcript

ebpl-201

ID
ZDB-TSCRIPT-090929-16883
Name
ebpl-201
Previous Names
  • ebpl-001
  • ottdart00000036399
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036399 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036399|OTTDARG00000027162|ZDB-GENE-030616-542 ebpl|OTTDARP00000029207 ebpl-001 LG_ BX294379.5 Danio rerio protein_coding KNOWN, 967 bp
ATTAAAAAAGTGCTTTCACTAGACAGAATGGCAGAATTCG
ACCAACAGCATGATGAACCTGCACTCTTCACTAAAGTAAC
TGTTTATTCTCTGCTCGCCTGTGTGGCTCAGTTTGCTGTC
GGCTTTGCCTTCGCTCAAAAATGGGGCCATAAATGTTCAG
CGGTTGACCGGTGGGTCCTCGTGTGGTTATTTTACGACGC
AATAGTTCATTTTACTCTGGAAGGACCATTCGTCTACATG
TCGCTTGTTGGAAATGTGGCGTCCTCAGACAACCTGCTGG
CAGAGTTATGGAAAGAATATGGCAAGGCAGATGAGCGATG
GCTATATTCAGACCCGACTATCGTTTCTCTAGAGCTTCTG
ACTGTGGTTTTAGACGGTTCATTGGCCCTACTTCTGGTCT
ACGCCATCATTAAAGACAAACACTACAGGCACTTTGTTCA
GATCACACTCTGTGTTTGTGAGCTGTATGGAGGCTGGATG
ACCTTCTGTCCAGACTGGCTGATGGGAAGCCCAAACCTAA
ACACTAGCAACTGGCTGTACCTGTGGGTCTACCTAGTGTT
TTTCAATGGCATCTGGGTGCTGGTGCCTGCACTCCTGCTC
TGGCAGTCATGGAAGGATCTAGAAAGACTCCATCAGCATC
CCGAGAAGAAGAACAGATGATTCAGAGGAGGCCTAATAAT
TAGTAATCATCTTTATAATTATTACATATTAGTGATGACT
CTAGAATTGCGGGTCCAATTTGCATTTCCAAAAACCAAAA
CTTTAATAACACATTATATCAAGTTTTCTGTAAAAAATGT
TTGCGTGCGCATTTAGGGACCTTTTTTATCTGGGAAAATG
TTTACTAAAAATCCTATTTTTTACCGTCTTGAATTACACA
TTATGCTATAATTATGAAATGAGTCTTAATTTTCTTATTT
ACGTGTGTTTATTCTACTAAGTAAAATAAACATTCGCATG
AAACGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations