header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16883
Transcript Name: ebpl-201
Previous Names: ebpl-001, ottdart00000036399

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036399 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036399|OTTDARG00000027162|ZDB-GENE-030616-542 ebpl|OTTDARP00000029207 ebpl-001 LG_ BX294379.5 Danio rerio protein_coding KNOWN, 967 bp
ATTAAAAAAGTGCTTTCACTAGACAGAATGGCAGAATTCG
ACCAACAGCATGATGAACCTGCACTCTTCACTAAAGTAAC
TGTTTATTCTCTGCTCGCCTGTGTGGCTCAGTTTGCTGTC
GGCTTTGCCTTCGCTCAAAAATGGGGCCATAAATGTTCAG
CGGTTGACCGGTGGGTCCTCGTGTGGTTATTTTACGACGC
AATAGTTCATTTTACTCTGGAAGGACCATTCGTCTACATG
TCGCTTGTTGGAAATGTGGCGTCCTCAGACAACCTGCTGG
CAGAGTTATGGAAAGAATATGGCAAGGCAGATGAGCGATG
GCTATATTCAGACCCGACTATCGTTTCTCTAGAGCTTCTG
ACTGTGGTTTTAGACGGTTCATTGGCCCTACTTCTGGTCT
ACGCCATCATTAAAGACAAACACTACAGGCACTTTGTTCA
GATCACACTCTGTGTTTGTGAGCTGTATGGAGGCTGGATG
ACCTTCTGTCCAGACTGGCTGATGGGAAGCCCAAACCTAA
ACACTAGCAACTGGCTGTACCTGTGGGTCTACCTAGTGTT
TTTCAATGGCATCTGGGTGCTGGTGCCTGCACTCCTGCTC
TGGCAGTCATGGAAGGATCTAGAAAGACTCCATCAGCATC
CCGAGAAGAAGAACAGATGATTCAGAGGAGGCCTAATAAT
TAGTAATCATCTTTATAATTATTACATATTAGTGATGACT
CTAGAATTGCGGGTCCAATTTGCATTTCCAAAAACCAAAA
CTTTAATAACACATTATATCAAGTTTTCTGTAAAAAATGT
TTGCGTGCGCATTTAGGGACCTTTTTTATCTGGGAAAATG
TTTACTAAAAATCCTATTTTTTACCGTCTTGAATTACACA
TTATGCTATAATTATGAAATGAGTCTTAATTTTCTTATTT
ACGTGTGTTTATTCTACTAAGTAAAATAAACATTCGCATG
AAACGTC

ebpl TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ebpl-201 967
ottdart00000001843 (1) 401
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ebpl-201 Contained in:
[BAC] DKEY-7A20 (1) (order this)

OTHER ebpl-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036399 (1)
  • Ensembl_Trans:ENSDART00000134450 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC124737 (1) 989 bp
    CITATIONS (2)