Transcript

ottdart00000001573

ID
ZDB-TSCRIPT-090929-22884
Name
ottdart00000001573
Previous Names
  • si:busm1-160c18.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001573 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001573|OTTDARG00000001462|ZDB-GENE-030616-171 si:dkey-33b17.3|OTTDARP00000001382 BUSM1-160C18.3-001 LG_ AL591176.8 Danio rerio protein_coding NOVEL, 754 bp
GTATTCAGCATGACTAAAATGTCACAGAAAAAGCTCTATA
GTTCTCTCATATTGATTTTGGCTCTATTCTTTGTAGGGGA
AAGTGCTAATGTATATTACATGTACCGTGTATCAAGATGC
ATCTTCAGCTCCTCTAATATCAGTGCCATGGTGTATTTTG
ACCGCACGTATTTCAATAAAAATCTATTCATACAGTTTAA
CAGCAATCTGGGGAGGTTTGAAGGGTTTAACGAGTATGGA
TTAAAACTTGCAGAGTTCTGGAACAATGGAACATTTGTAG
ATCAGGAGAAAGACGTTGTGGAATTTTTCTGCAAGTATAA
TTCTCAAATCTATGAAAACAGCATCTTAGATAAAGCAGTG
AAACCAAAGGTTAAGCTTAGTTCAGTGACCCGGGCCGGTG
GAAGACAATCAGCAGTTTTGATGTGCAGCGCATATGATTT
TTATCCTCCACACATCAACGTGTACTGGTTGAGAAATGGT
GAAGTGATGACCTCTGAAGTGACCTCAACTATGGAGATGG
CTGATGGTGACTGGTATTACCAGATTCACTCTGAGCTTGA
ATACAGTCCGAAACCTGGAGAAAGGATTTCCTGTGTGATT
GAACATGCCAGCTCTAACAAACCCATGATTTATGACTGGG
ATCCATCTCTTCCTGTCTTTGAGAGGAATAAAATTTCCAT
CGGGGTTTCTGCTATTGTGCTGGGAATCATCACTGCAGCT
GCTGGAATCATTTACTACAAGAAGAAGACTACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations