Transcript

pcdh15a-201

ID
ZDB-TSCRIPT-090929-22832
Name
pcdh15a-201
Previous Names
  • pcdh15a-001
  • ottdart00000040494
Transcript Type
mRNA
Annotation Status
fragmented
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000040494 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040494|OTTDARG00000020950|ZDB-GENE-030616-3 pcdh15a|OTTDARP00000032362 pcdh15a-001 LG_none CU467884.4,BX548002.12,CU075715.4,CU856144.6,CU467855.6,BX005204.8 Danio rerio protein_coding KNOWN, 6495 bp
AGAGAAGGTTGAATGAGGGTTGTGTGAGGTGGGCTGTACT
TTAACTCGAGCTGTCATTCTACTTTCTATCGTTACTTGAG
GACTAACCAACACCGTCCTGGATCCGACCTGCTCTTAAGC
GTTTAAGGAGAATCAGTAAGAAGTAAAATTACCGGTTCTC
TGGCGGTCCGTCCTCGTCAGTGAAAAAGACACATACCTAC
TGCAACTGATGGGATTCGTTGCGTGGGTCTGTCCGGGGAG
ACTCAGCTTGGATTTTAATCCGACATGGTGGGTTAACGTT
TGAGTGAAACGGAGACCGTCCGGTAAATTCCTGACAGGAG
GAATGAATGATTCCCGCGCGGCGCGTGAGTGAAAAACGCT
CGCGTAACTGTTGCTGTGAACGGCGGTCTGCGGGAACATG
AGGAAAGGAAATAACTGAAATAAACTGCGTGGGTTGGCAG
TAGGCATTAAGTGAAGATGCGGAGGCGCTGGTGGCGATTG
GACTGTCTGGGTTCAGCAATTGCCTTGTTTGTTATCATCA
GCCAAATCTCAGCTCAAAACACTGAAGACTGGCACTATGA
GGAGTGTAAATTGTCACGATCGGGTCCGCCTGCCACTATC
GTCACCATTGATGAGGAAAGTCCGAATGGTACGATTTTGG
TGGAAAACATGCAGATCAACGGTCGAGCTCGGGATCCAGA
CAGAACCATCTCTCTGACACTGCTGGACAACTATGACTAT
TGGGTTATTCTTGACCCTGCCCTGCAGAGACTGTTCCTCA
ACAGCACCGGACGTGTGCTGGACCGAGACCCGCCAAGCTC
CATCACTACCATCGTGGTTCAGATCCAGTGCACCAATGAG
CTGGTGGGAACGGTTATTCTGCATGAAGTACGGATAGTGG
TGAGGGACAGAAATGACAACACGCCTCGTTTCCAGCAACC
TCGTTACTATGTATCAGTTAATGAGCTCACTCCTGTTGGC
ACCACTATCTTTACCGGCTTCTCAGGAAACAATGGAGCCA
CGGACATTGACGACGGACCAAACGGACAGATTGAATACGC
CATTCAGTATAACCCAAATGACCCGATGTCAAACAGGACG
GTGCGGATTGCTGGGACGCTGTCTGGTAACATTGTTTTGG
CAGAGCGGCTGAACTACGAGGAGAGAACTCGATATCTAAT
TATAGTCCAGGCCAATGACCGGGCTCCATATCCAGGAACG
CGGCGCACAGCTACCACTACTCTGACTTTGGATGTTTTGG
ATGGAGATGACCTGGGCCCCATGTTCCTACCGTGTGTGCT
GGTCAACAACACGCAGGACTGTAACCCCGTCACGTACCGA
GTGGCTATTCCTGAGCTCACAGACCCAAACAAGCTGAACC
CTCTGAATGTGACGCCTCCCATCCGAGCCATAGACCAGGA
CAGAAACATTCAGCCGCCCTCAGATAGACCTGGAATCTTG
TACTTCATACTGGTTGGCACACCTTCTACGTACCCAGAGT
TCTTCACTCTGAACAGGAGCACGGCTGAGCTGCGGCTGCT
GAAGTCTGTGGACAGAGAGCTTTACCAGCGCTTCTCTCTC
GTCATTAAGGCAGAGCAGGATAATGGTCATCCTCTTCCTG
CGTACTCGAAGCTGGAGATCGAAATTCTGGACGAGAACAA
CCAGGCGCCGTATTTCCAGCAGTCTTCGTACCGGGGCTTC
GTCAGTGAATCCTCTTCTGTCGGCACCACCATCTCAGCCA
GCGCCAACCTCACGGCCCCGCTGGCCATCATAGCTCTGGA
CAACGACATTGAAGAGACTAAAGACCCTCAGCTGAAGATC
ACTCTGAATGAATACACCTCCATCTTCACCATCACTACTA
GCGGCATCACACGATTCCTGACCCTGCTGAAACCAGTGGA
CCGAGAGATACAGACCAACTACACATTAACGCTGGTGGCG
ACTGATGGTGTTCAGCAAAGCAGACCCGTGACGGTGGACA
TCCTGGTCATCGACGCGAACGACAACACACCCACCTTCGC
TCAGGTGTCGTACAGTGTGGAGATCTTCACTAACATGCTG
CCTGGAGAGACCGTCCTGCAGCTGATGGCTCAGGACGCTG
ACGCTGGTTTAAACGGCCTCATCACATATGCCATACTGGC
TGGAGATCACGGGGATTTCATCATCAACAACCGTACAGGA
CGAATCACTTTAGCACCAGGGGTCATGCTGACTGTCGGCC
GTTCATACGCACTGACCGTAAGAGCTGCAGACAATGCTCC
TGACACTGAGAGGAGGAGCTCCATTACTACGGTTTACATA
GAAGTTCTGCCACCCAACAATCAGAGTCCTCCACGATTCC
CCTTACAGACCTACAACCTGGAGATCAGCGAGGCCATGAG
GATAGGAGCCATACTGCTCAACCTGCAGGCTACAGACCGT
GAGCTGGATCCAATCACCTACCGGATAGAGACCGGTGACC
CACAGGAGGTCTTCAACCTTTCACGAACTATAGGTCTTCT
GCTGCTGGCCAAACCTCTGGACAGAGAGACCATTGACCAG
TACCGTCTCATCGTCACTGCATCTGACGGCCATCCAGGAG
GGATTTCCACTGCCACCGTCAGCATCGTCATCACAGATGT
TAATGACAACGACCCCACATTTGACCTCACTTTACCCAGA
AACCTGACAGTGCGGGAGGAAGAGGCCAATGTGTTTGTGG
GTCAAGTCAGGGCCACTGATCCTGATGGCGGCCTTAACGG
TCAGGTTCGCTACCGGCTGCTCTCCTTTGCGTCTCTGTTC
TCCATAAACTCCACAGGCAGCATCTTCACTGCCGTCCCGC
TGGACAGAGAGACCCGCAGCCGGTACGATCTGATCGTGGA
GGCGTCAGATGGAGCGGTGGATCCACGCAGGACCACCATC
ACACTGCTGGTAGAGGTGCTGGACATCAACGACAATAGTC
CAGTGTTTTCTCAGCCTGTCTACACAGTCAACGTCCCAGA
AAACACACCGGCTGGATCCATCATCCTGAGACTCACTGCG
GTGGATGCCGATCTGGTCTCTAATGTGACCTACAGGATAA
AAACAGAAGCGGCTCTGCAGCTCTTCGCCGTGAACCGTCT
GACCGGCGTCATATCAGTCCTGCAGGCGCTAGACTTTGAG
TCCTTGGCAGCAGGAAACAGCACCTACACGTTTGAAGTGG
AGGCGTTGGATCACGGTGGAGTCCTGCCTCCAGGAACGGC
CACAGTCAGCGTTAGAATCACGGATATGAATGATTTCTCG
CCGGTTTTCAGACAGGCTCTTTATAAAGGACTGGTGGCTC
CAAATGCAGAGAAGGGAACAGTCATCACAACTGTACTAGC
AGAAGATCAGGATCCTCCGGGTACTCCTGCCAGTAAAGTG
CGCTACAGAGTGGATCAGGAACTGTCTCCTTACAGTGGAA
GCATCTTTGATGTAGAGACGGACACAGGACTGGTTATCAC
CAAAGTCAACCTGAATGAGCAACCCACCACTGTTTTCAAG
CTGGTGGTCATGGCCTATGATGACGGTGAGCCGGTGAAGA
CGAACAGAACCACTGTGGAAATCACTGTTCTTCAGCCCTC
CAGAATTCCCATCTTCACAGAGGAGGAATATAGGTTCAGT
CCGGTGAGTGAAAACGCACCTATCGGAACGCCTGTAGGAT
TGATTCTGGCCGCGGCCACCAACACCACTGTGGTTTACTC
CATAGTGAGCGGAAATGAAGGAGGTGTGTTCACAGTCAAT
AAAAGCACCGGGATCATCTACACAAATAAATCTCTGGACT
ATGAGAATGTGACCAGTTATGTGCTCCGGGTTCAGGCCGA
TTCTCTCACCGTCATCCTCGCCAACCTGCGCGCCCCCTCC
AAAACAAACACAGCCAAGGTATTCATCAACGTTCAGGATG
AGAACGATCATCCTCCGGTCTTTTCGAGGCAAGTGTATAT
TGGAGGAGTGACTGAAGACACTAAGACCTTCACCACAGTG
CTGAAAATTGTGGCTACAGATGTTGACACTGGGAACTACA
GTAAGATGGCCTACAGACTGATCATCCCCCCCACAACTGA
GGGGCAGGACAGTTTTGTGATTGAGCCCTACACCGGAGTC
ATCAAGAGCGCCATCATGTTTAGAAACATGCGCCGGTCCT
ACTTCAAGTTTCAGGTCGTCGCCACAGATGACTATGGAAA
GGGGCTCACCAGCAAAGCAGATGTAGTGGTGTCTGTTGTG
AATGCTCTGGACATGCAGGTGGTGGTGTCTAATGTTCCTC
CTACAGTGGTGGAGGAGAATAAAGAACAGCTGATCAGTAT
TTTGGAGCGGTACGTGCAGGATCAGATCCCCGGTGCTAAA
GTGATAGTGGAATCGATCGGACCGCGGCGGCACGGTGAAG
GTTATGAACTTGAAGACTACTCAAAATCAGACCTGCAGGT
GTACGCCATCGACCCGCTCACCAACAGAGCCATCTCCAGA
CAAGAGCTCTTCAAATTCCTGGATGGCAAGATTCTGGACA
TCAATAAGGAATTTCAGCCGTATCTGGGCGAGGGTGGGCG
TATTCTGGAGATCCGCTCTCCTGATATAGTGGCCACGGTG
AAGAAAGCAGCGCAGGCCGTGGGCTACACTGAAGGAGCTC
TGCTGGCCCTCGCTATCATCATCATTCTCTGTTGCATCCC
TGCAATCCTTATCGTCATGGTTACTTACAAACAATTCAAA
GAGAGGCAGGCCGAATGTGCCAAAACTGCCCGTATCCAGA
TGGCACTTCCTGCGGGCAAATCAACAGGAGGTGGCGGTGG
CGGTGGTGGTGGTGGCGGCGGCGGTGGCGGCGCTCAGACC
AATTTGTACGAGGAGCTGGGAGACGGTGGCATGCTTGGAC
TACAAAGACGCAGAAGGTCTGTAATCGAGGAGGCGGACAG
ACAGAGCCTCATACGAAACTTCGCCTCGCGTGCCATTGCT
GCTCACAAACAGACCACTGGAAACGGACAGATGCGCAGCA
AGCTTCCCAAATCAGAAAGCGCCATCACCTTCCTGTCAGA
CGAACGGCCACTCACTACTCAAAATCCCATTTTCCAGGAT
GGCCTATCTAGTAGTCCGGAACCTAACTTGGAGGTCCGAA
GGATTAGTGGTTTTCTGTACAGTGACCCACCTTCTCCAAC
AAGCCCCTGTGGTCAATTCACCTCATGGTCACTGCCATCC
AGAATTCGAGGACGAGGATTTTACAGTACTCTGCGCAGAC
AAGCTCTCTGGGACCCGGCCCAGTGGGAGGAGCAACAGCT
GAAGGCGGAGCTTACAGACAGCAGGGAGGAGCTTGATGCA
GATCAAAGTGGTCGGAGTACTGAAACAAAACTATCAGTCA
GAGAACAGGCCAGACAGTTTGAGGCTTTGGCTGATCGAAC
CCCCAGGCAAAGTCGTGACTCTTACGCATCTTTGGATCCT
GACGACCCACTGCTGGGCACCATCATGCTTTCGTATAGTA
CAATTTCTGTTGGCAAGGACAGCCCGCCATGCATTATCAT
AACAGGGGACGATGGTGAGACTCCTCCTCCACCCACAGCT
CAGCGACCGACTCCACCGGTTGTGAGGAAGTTCAGCTCCA
GCATCTCAAATTACATGACAGTGGAGCCTTGCGAGATTTT
GTTGGAATTCATATCAGACTTTCCAGGGAGCCCACCTCCA
TCCCCTCCATCTCTTGTCCCATCACGCTCTTTTCTTTCTC
CTCCATGTCTGGAACTTGACTGTACCCCGCCACCGACCCC
ACCTCCCATCCAGTCTCCGGAAATCCCTGTTCAGTGTCCG
ACATTTAAACCGAAAGGCATCCTGAAGAACTCTGACAGAT
TCGGTTGCAGCCCTGATGTTAAATATGACAACAAGAACGA
TGTATAAGCCAGCCAATCAGAATCAGACTTTTGTGCTCCG
CCCTCAATCCCAGCAGAATAAGAGGCCCCGCCCACATCAG
ACTTTCTTTTCTGAACTCTGGAACTCTTTTCATATTTTCT
TTCCCAAACTTTCTCTTTCATTATTTACATTTCCTTGAAT
TATTTGTAGAGCACTTTACTTTGAGAGCACTTTATAGTAA
ATGTAAACATTGTTTGTGGCCATTGCTTAAAAGTGCAGTA
GGTGATTGTTTTCAGAACCATTTTGTGTTGTGCTGGTTGA
AAGTCTCTTCACAGTCCAAAAGTAATGATTAAAGTAAATG
ATCTAAATATGTTAATAAATATTTTTTAAATTCTGGGTGA
GGCGTAAAACTAAAAAATGTTCATCCAATTAAATAGAGTC
GGGCCGACATCTCTCATAATTCCGATAAGTAGGTCAAATT
GTCTGTCAGCAAATGCAGATTTGAACAACTGCGCAGCCGT
TTGTACGCAGCTCCACCGACCGGCATTTTAGGATTTGATT
AGATTGAATTCAACTTTATTGTCATTACACATGTACAAGT
ACAATGCAACGAAATGCAGTTTAGGTCTAACCAGCAGTGC
AATAGCAGCAAGTGCAGGATACAGGTATAAGGTATAAAGT
GCAGTTATAGAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations