Transcript

dusp5-201

ID
ZDB-TSCRIPT-090929-2257
Name
dusp5-201
Previous Names
  • dusp5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000012601 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012601|OTTDARG00000010873|ZDB-GENE-010625-1 dusp5|OTTDARP00000010819 dusp5-001 LG_ BX649360.12 Danio rerio protein_coding KNOWN, 1522 bp
ACTCAGGCTCAGTACGCAGGGTTTAGTAGGCAACCTACAC
CCCTGAAACATCCACATCCCTATTTAAAACACATTTCACT
TTGTCATTTCAAACATGAAGGTCTCCAGCATAGATTGCCG
ACGCCTGAGGAAGATCATACGGAAGGAGTGTGGAAATTGT
CTTATTGTGGACTGTAGACCGTATTTCTCCTTCTCGAACT
CTTGTATCAGAGGCTCCGTCAATGTGAACTTGAATTCGGT
GGTTGTCCGGAGGTCCCGCGGTGGTCCGGTTCCTCTACAG
TTCGTCATTCCGGACGAGAAAGCCTTATTTCGGCTTCGGG
AGGGCAGCATCTCCGCTGTCGTGGCTCTGGACGACCGCAC
ACCTCATTTACAGAAACTGAAAAAGGACAGCATTGCTCAG
ATAGTTATTAATACTTTGTCGCACTTGACGAGTAGCGCGA
GCATCTGCTTCTTAAAAGGAGGCTATGAGAACTTCCATGC
CCATTACCCTGAGCTTTGCACTGAAACCAGGTCTGTGGAA
GTGAGTGAAGACAAAAGCGAAAGAGGCGTCAGCAGTCACT
GTGACAAACTGGCTTCTCACCACAAACCAGACTATGATCA
GGGACGGCCGGTGGAGATCTTGCCTTTCCTGTACCTGGGC
AGTGCCTATCATGCCTGCAGACAGGACTATCTCAGTGACC
TCCACATCACAGCCCTGCTGAACGTCTCACGCAGAGACTC
TCGGCCCGCCAGAGGACAGTACAACTACAAATGGATCCCG
GTGGAGGACAGTCACACGGCCGATATCAGCTCACACTTCC
AGGAGGCTATCGATTTCATTGAGCGCGTGAAAGCAGAGGG
AGGTAAAGTGCTGGTCCACTGCGAGGCGGGAATCTCTCGC
TCTCCCACCATCTGCATGGCGTACATCATGAAAACCCAGC
GGTTGCGTTTGGAGCAGGCCTTTGACGTCATCCGACAGCG
GCGTGCCATCATCTCGCCCAATTTTAGCTTCATGGGTCAG
CTGCTGCAGTTCGAGTCTGAGGTGGTTTCTTCCACACCTC
CACTAGTGACTCCAGCAGCTCAAGAGACACCCACTTTCTT
CAGCGGAGACTTCACACTGGAAACGGAGAGCTTTGAATCC
TCGGTTTTCACCTTCCCTACCTCCTTCCTGACACCCATCC
AGCCATCATTCAAACTGAGTCCAATAACTGCGCTGCCTTA
AAATGGCTGCCCGACTCATCGCAATCTCAGTGTACTTGAA
AAACAAAGGACAGTCGAACTGAACAAAGCAATGGTGTATC
ACAGGGAATACAAAAAAAAACACTTGTTTTAATATTTAAA
GATTGAAGAACAGTGTTTGCTTTTTGATTTTGTTTGCCTT
AGAGAAAACCACTGCACAATGATTACTCTGCAATACCTGC
CTTAGCTTGATGATGTTCTGCCTATCAGCGCCTGGCTGGG
CAAATTAAATTATTATTATTTTTAAACTGTTTCTTTTTTT
ATGAATTGTGCATCTGTTAATAAATGTTTTTACAGAAGTG
TA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations