ZFIN ID: ZDB-TSCRIPT-090929-22507
Transcript Name: tuba1a-201
Previous Names: tuba1a-001, tuba1l-001 (1), tuba1l2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026990 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026990|OTTDARG00000021268|ZDB-GENE-090507-4 tuba1a|OTTDARP00000022121 tuba1l2-001 LG_ BX465853.12 Danio rerio protein_coding KNOWN, 1537 bp
GTTGTCGAGCTGTAAGATCTCTCCGCCAAGACTTCTTTCT
TCCCCGGCCAAGCAACACTACTAGAAACAATGCGTGAGTG
CATCTCTATCCACGTTGGTCAGGCTGGAGTTCAGATCGGC
AATGCCTGCTGGGAACTGTATTGTCTTGAGCATGGCATCC
AGCCGGATGGGCAGATGCCCAGCGACAAAACCATCGGAGG
AGGTGATGACTCCTTCAACACCTTCTTCAGTGAGACCGGA
GCTGGAAAACACGTCCCTAGGGCTGTCTTTGTAGACCTGG
AGCCCACTGTCATTGATGAGGTGCGCACTGGGACATACCG
TCAGCTGTTCCACCCTGAGCAGCTCATCACAGGAAAGGAA
GATGCTGCTAATAACTATGCTCGTGGTCACTACACTATTG
GAAAGGAAATCATTGACCTGGTGCTGGACAGGATTCGCAA
ACTGGCTGACCAATGCACAGGTCTCCAGGGTTTCCTGGTC
TTCCACAGCTTTGGTGGTGGCACTGGTTCTGGCTTCACCT
CTCTGCTGATGGAGCGTCTGTCTGTCGACTACGGCAAGAA
GTCCAAGCTTGAGTTCTCCATCTACCCCGCTCCTCAGGTC
TCCACCGCTGTGGTAGAGCCTTACAACTCCATCCTGACCA
CCCACACCACCCTAGAGCACTCTGACTGTGCCTTCATGGT
AGACAATGAGGCCATTTATGATATCTGCCGTAGGAACCTT
GACATTGAGCGCCCTACTTACACCAACCTCAACAGGCTAA
TTGGCCAGATTGTGTCCTCCATCACAGCCTCCCTTAGGTT
TGATGGTGCCCTCAATGTGGATCTCACTGAGTTCCAGACC
AACTTGGTGCCCTATCCTCGTATCCACTTCCCTCTGGCTA
CCTATGCCCCAGTGATCTCCGCAGAGAAGGCTTACCATGA
GCAGCTCTCTGTGGCTGAAATCACCAATGCTTGCTTCGAG
CCGGCCAATCAGATGGTCAAATGCGACCCACGTCACGGCA
AGTACATGGCCTGCTGTCTGCTGTACCGTGGTGACGTGGT
GCCCAAAGATGTGAACGCCGCAATCGCCACCATCAAGACC
AAGCGCACCATCCAGTTTGTGGACTGGTGTCCCACTGGTT
TCAAGGTTGGCATCAACTACCAGCCTCCCACTGTGGTTCC
AGGTGGTGATCTGGCTAAAGTGCAGAGGGCCGTGTGCATG
CTGAGCAACACCACAGCTATTGCTGAGGCCTGGGCTCGTC
TGGATCATAAGTTTGATCTGATGTACGCCAAGCGCGCCTT
TGTGCACTGGTACGTGGGTGAGGGTATGGAGGAGGGCGAG
TTCTCTGAGGCCAGGGAGGACATGGCTGCCCTGGAGAAAG
ATTATGAGGAGGTTGGTGTCGACTCCATCGAGGGTGAGGG
AGAGGAAGAGGGCGAGGAATATTAAGTGACACAAATAACA
TGCAGGAATCATGAAATTCAAACAGTGAAAATTGGACAAC
CAATGGAATTATGATGGTACAGTTCTTTGAGCTGAAATAA
ACCTCCTTTCCAAACTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tuba1a-201 Contained in:
OTHER tuba1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026990 (1)
  • Ensembl_Trans:ENSDART00000009277 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC067554 (1) 1564bp
    CITATIONS (2)