Transcript

snapc4-203

ID
ZDB-TSCRIPT-090929-22499
Name
snapc4-203
Previous Names
  • dkey-1o2.5-001
  • snapc4-001
  • ottdart00000022803
  • si:dkey-1o2.5-001
  • wu:fi18h02-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022803 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022803|OTTDARG00000018726|ZDB-GENE-030131-5794 snapc4|OTTDARP00000019053 DKEY-1O2.4-001 LG_none CU856180.13,CR381619.10 Danio rerio protein_coding NOVEL, 1880 bp
CAGCGATCATGACACTGACTCTAGTGAAGACAGTGCTGAC
GATTTAGAGCTTCCACAAAATGTGGAGACTTGCCTGCAAA
TGAATTTGGTCTATCAGGAGGTGCTAAAAGAGAAACTAGC
TGAGCTAGAACAACTGCTCATTGAAAATCAACAGCAGCAG
AAAGAGATCGAGGTCCAGCTCTCTGGCCCAGGCAACTCTA
TCTTCTCAGTACCTGGAGTTCCTCCTCAGAAACAATTTCT
AGGATACTTCTTAAAGCCTTACTTCAAGGACAAACTCACC
GGTTTGGGTCCTCCAGCTAATGAGGAAACTAAAGAGAGGA
TGAAGCATGGTAGCATACCTGTTGATAATCTGAAAATTAA
AAGATGGGAGGGTTGGCAGAAGACTTTGCTGACCAATGCA
GTTGCTAGAGACACTATGAAACGAATGCTGCAACCTAAAC
TATCCAAGATGGAATATCTCAGCAACAAACTGTGTAGAGC
GGAAGGCGAGGAAAAAGAACAACTGAAAGCGCAAATAGAA
TTAATTGAGAAACAAATAGCTGAAATAAGAACCCTGAAAG
ACGATCAACTGTTGGGTGATCTGCAAGACGATCATGACTG
GGATAAAATATCAAATATCGATTTTGAAGGTTTGCGTCAG
GCCGATGATTTGAAGAGGTTCTGGCAGAACTTTTTGCACC
CGTCCATTAACAAATCGGTGTGGAAGCAAGACGAGATTTA
TAAACTACAAGCAGTCGCAGAAGAGTTCAAGATGTGCCAT
TGGGATAAAATCGCAGAGGCTCTTGGGACCAACAGAACAG
CTTTCATGTGCTTCCAGACCTACCAGCGCTACATTTCAAA
GACATTCAGAAGGACTCATTGGACAGAAGAGGAAGACGAT
CTCCTCAGAGAACTTGTTGAAAAAATGAGGATCGGGAACT
TCATTCCTTACATACAGATGTCACATTTTATGGTGGGTCG
TGATGGATCTCAGTTGGCATATCGCTGGACATCTGTCCTG
GATCCCTCATTAAAGAAAGGCCCTTGGTCCAAAGAGGAGG
ACCAGTTGTTGCGGAACGCTGTGGCAAAGTATGGGACCAG
AGAATGGGGGAGGATTAGAACGGAAGTGCCAGGCAGGACC
GACAGTGCTTGTCGAGACAGGTATTTGGATTGCCTTCGGG
AGACTGTGAAAAAGGGAACATGGAGCTATGCAGAGATGGA
ATTATTAAAAGAAAAAGTTGCAAAATATGGTGTCGGCAAA
TGGGCCAAGATTGCCTCTGAGATCCCAAATCGAGTTGACG
CTCAATGCCTTCACAAGTGGAAATTAATGACACGATCTAA
AAAACCCCTAAAAAGACCACTATCAAGCATAACAACAAGC
TATCCAAGAAATAAACGACAAAAATTGCTGAAAACAGTTA
AAGAAGAGATGTTTTTCAACTCCAGCTCTGATGACGAAAG
CCAGATAAACTATATGAACAGTGACGAATCAGACGATCTC
GCAGAAGATGAAAATCTGGAAATACCACAGAAGGAATACG
TGCAAACAGAAATGAAGGAATGGATTCCTAGAAATGCGAT
GGTATGGACGATTACTCCAGGAAGTTTCAGAACATTATGG
GTCCGTCTTCCCACCAATGAAGAGGAGCTACGGGAGTCCA
CTAAAGAGTCCGGCTTAGGCTCCGATTCTTCAGAGAACAG
CGCGTGTCCAAATGATGAGCCCATAATGGAGCGCAACACC
ATTCTGGACCGCTTTGGAGACGTGGAAAGGACTTACGTTG
GCATGAATACTGTTGTCTTGCACAGACGGACTGACGATGA
GAAGGCCATGTTCAAAGTGTGCATGAGTGATGTTAAACAA
TTCATTCAAATGAAAGCAACAGAATTCGCTGTGAAGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations