Transcript

uckl1b-202

ID
ZDB-TSCRIPT-090929-22401
Name
uckl1b-202
Previous Names
  • uckl1b-002
  • si:dkey-256k13.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042707 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042707|OTTDARG00000030758|ZDB-GENE-090311-45 uckl1b|OTTDARP00000033912 DKEY-256K13.1-002 LG_ CR391935.9 Danio rerio protein_coding NOVEL, 795 bp
TCATGTTAGCCAGAGACTCCAGGGTTCGTCTTGAATGGTG
ACGGAGAAACCACAACAAATCAGACGTACTGTAGAAAGCA
CACTTTTGTTTTCCTCCCCTTTGCGTCAGTTTCGTTTTAC
TTCCTCTCCTCGGCTTGCCAGAGGGCAGGCACCACACTGT
GTGCCTGCGCATGTGTTTTGTCCCAGCGCTTATTAGTGCT
GATCTTTCTTTGGAGCTTTCATAAGACTGTTTGGTCATGA
ATACACTCCCAGCGTTTTCGGGAGCCAGAATATCAGGCTG
CTGGGCTCTCAGGGCTGATGGAAGTGGTGGTGCTGAAGAC
TCTCTGGACAGACTCCTCCCCACTGTCAACACTAGCCTGT
CACCTCGGAAACGAACCACCAGTCAATGCAAATCAGAGCC
TCCTCTGCTCCGGACCAGTAAGAGAACCATCTACACAGCC
GGACGGCCACCATGGTACAATGAGCACGGGACGCAGTCCA
AAGAAGCGTTTGTCATTGGACTTTGCGGAGGCAGTGCCTC
AGGGAAAACAACAGTCGCTCGTAAAATTATTGAGGCTTTG
GATGTCCCTTGGGTGGTTCTTCTGTCAATGGATTCCTTCT
ATAAGGTTCTGACGTCTGAACAGCAGCTGCAGGCCGCTAG
TAACGATTACAACTTTGACCATCCAGACGCCTTTGATTTC
GTCCTGCTGGTTCACACGCTCCGCAAACTCAAGCAGGGCA
AGAGCGTCAAGATCCCAGTGTACGACTTCACCACACACGG
ACGCCAGAAAGAATGGAAAACAGTGTATGGTGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations