Transcript

uckl1b-201

ID
ZDB-TSCRIPT-090929-22400
Name
uckl1b-201
Previous Names
  • uckl1b-001
  • si:dkey-256k13.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042706 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042706|OTTDARG00000030758|ZDB-GENE-090311-45 uckl1b|OTTDARP00000033911 DKEY-256K13.1-001 LG_ CR391935.9 Danio rerio protein_coding NOVEL, 2720 bp
ATCCCAGCAGCATTAGCCTGGCCTAAAGTCGCAACAGCTG
ATTGTCAAATAGGAAACTAACAATGTCTGCCGTGTGCGGA
GACGGAAGAGATTCAGCGATGGAGTGTGGAGAAAAATCAT
CTGCTCGGTGCACAAGTGGTGGTGCTGAAGACTCTCTGGA
CAGACTCCTCCCCACTGTCAACACTAGCCTGTCACCTCGG
AAACGAACCACCAGTCAATGCAAATCAGAGCCTCCTCTGC
TCCGGACCAGTAAGAGAACCATCTACACAGCCGGACGGCC
ACCATGGTACAATGAGCACGGGACGCAGTCCAAAGAAGCG
TTTGTCATTGGACTTTGCGGAGGCAGTGCCTCAGGGAAAA
CAACAGTCGCTCGTAAAATTATTGAGGCTTTGGATGTCCC
TTGGGTGGTTCTTCTGTCAATGGATTCCTTCTATAAGGTT
CTGACGTCTGAACAGCAGCTGCAGGCCGCTAGTAACGATT
ACAACTTTGACCATCCAGACGCCTTTGATTTCGTCCTGCT
GGTTCACACGCTCCGCAAACTCAAGCAGGGCAAGAGCGTC
AAGATCCCAGTGTACGACTTCACCACACACGGACGCCAGA
AAGAATGGAAAACAGTGTATGGTGCAAGTGTTATCATCTT
CGAGGGCATCATGTCATTTGCGGATAAAGAGCTGCTGAAG
CTGCTGGACATGAAGATCTTTGTGGACACTGATTCTGACA
TCCGGCTGGTACGGAGGCTCAGGAGGGACATCACAGAGCG
TGGACGGGACATCGAGGGAGTCATCAAACAGTATAACAAA
TTTGTCAAGCCGGCTTTTGAACAGTACATTGAGCCAACCA
TGAGACTGGCAGATATTGTGGTGCCAAGGGGGGGTGGAAA
CATGGTGGCCATTGACCTGATAGTGCAGCATGTACACAGT
CAGCTGGAGGAGCGAGAGCTCAGCGTCAGGGCGGCGCTGG
CATCTGCTCATCAGGCACAGCCGCTACCACAGACTCTGAG
TGTTCTGGAAAGCACACCGCAGGTCCGCGGCATGCACACC
ATCATCAGAAATAAAGACACCAATCGAGACGAGTTCATCT
TCTACTCCAAGAGGTTAATGCGGCTCCTCATCGAGAGAGC
GCTGTCCTTCCTTCCATCTCAGGTCCACATTGTTCAGACC
CCACAAGGAGAGGATTATGAGGGCAGAATCTTTCATGGAA
AGAGGATTACGGGCGTGTCGATTCTAAGGGCGGGAGAAAC
CATGGAGCCTGCGCTTAGAGCCGTGTGCAAAGACGTCCGC
ATTGGCAAAATCCTCATCCAGACCAATCAGGACACAGGAG
AGCCTGAGTTACACTACTTGCGTCTACCCAAAGACATCAG
CGAGGATCATGTGATTCTGATGGACTGCACTGTGTCCACT
GGAGCGGCAGCCATGATGGCCATCAGAGTTTTACTAGATC
ATGATGTTCAGGAGGAAAAGATCCTGTTGGTGTCTCTGCT
GATGGCCGAGATGGGTGTTCATTCAGTGGCCTACGCTTTC
CCTCAGGTCAAAATCATCACCACCGCCGTCGACAAGAAGG
TCAATGACCTCTTCCACATCATCCCCGGCATAGGAAATTT
TGGCGACCGTTACTTTGGCACGGACGCTCCTACAGACTGG
AGCGATGATGACATGGACGAGCCGAGCTGCTGAGAGACTA
ACATTTGTACATTTTATCCAAAAACAATATTTTTATACAT
TTTTTGCACTTCCCAAATGGAAAAAAAGAGTGTTTTTATT
TGTGACCTTTTTATTTATGAACGCTTATTTAATGCTATAT
TTAACATGTACAACTGAAGCACATGCAGTTGCATCATTGC
CTTACGTGTTTTTTGCTACGGTTGTAGTACTTTAGCCATA
TGAACACAACATGCTTGTTGCTTTCATTATTTTCTCTACT
CAGTTTCATGCAGCAGAGCTTTTCAGAGGGTAAAATAAGC
CTCAAAGTGCTGCTGTGCTACACTTAGACCGTGAAAATTC
TTTGAAGGACCACTTCGTCGGAAAAAACACGTGGGCGTTG
CTTTTGTTTTAATCTTTTGCTTTCTCGCTTTACCTGCAGA
CGAATGCTGACCAAACCACAGACTGCTCACAAATACACTT
TCACAACACAGTACCACCACTCTATGCAATGACTGCGCTA
TAAAACCCTCAAATATTGAGCTTTTCTTCATTGATTAATA
AATCAAACATATAAGCTTGAGTCAACAGCTTTCTGTCAAA
CGCGGAAATGATCACAACTCCATTTAAAAGAAAAGCACAT
TCTGTAAGATTGACCGACCTGCTTTTGTTGAAGCCACAAA
GACAGTTATATTTTTATCTGGCCATTGAGTTCATAGCTGG
CTTTACCATATATGGCTCTGTCATCTCAATGTTCATACAA
AACGTCACTAGATCAAAACTAGCCCACAGGAAGCGCTGGT
GTTTGGCCTGAAGTTCAGCCCCCCGAAACCTCTTAGTGTA
TTGTCAGTGTCTCGGTTTTATTATTTTTACCCCGCTGAGC
ACTCTGACTGATTAATTCATCGCTGTGAAACTTGATGTGT
ATGTGTTGTTTGTTTGAATGACGCTGATTTGAAATGTGTG
TATATTTGTAAACTATGAAAATGGCATGTTTTTTTAATGC
TCGGCAAGGCCTATTGAATGTATCCACTGTGATGTTTTGT
TGAACAACGGGAATAAAAATCATACGTTTATGGATGTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations