Transcript

rgs19-002

ID
ZDB-TSCRIPT-090929-22124
Name
rgs19-002
Previous Names
  • zgc:194426-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042400 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042400|OTTDARG00000030587|ZDB-GENE-080723-72 rgs19|no_translation CH211-86I10.1-002 LG_ CT025851.12 Danio rerio protein_coding KNOWN, 864 bp
TTTATTTATTTACTTTTTTATTTAAGTATCCACTTTGTAA
GCCAATATGTTTATAGGGACTTGAATATACCTAATTGTTA
TATCTCTCTGTCTCTCGCAGTCCCAAACCGACGATGGAGG
AGATTAAACAGTGGGCGCAGTCTTTCGATAAGCTGATGAA
AAACCCAGGGGGGCGGAACAAGTTTCGTGAGTTCCTGCGG
ACGGAGTACAGCGAGGAGAACATGCTTTTCTGGCTGGCCT
GTGAGGACCTGAAGAATGAGATCAACAAAAGTGCCATCGA
GGAGAAGGCGCGTTTGATCTATGAAGACTACATCTCTATC
CTCTCGCCCAAAGAGGTGAGTCTGGACTCTCGCGTGAGGG
AAGTGATCAACAGGAGGATGCAGGATCCCACCCCTCACAT
ATTTGAGGACGCACAGCTGCAGATCTACACCCTCATGCAC
AGAGACTCCTACCCACGATTCCTCAACTCCTCCGTCTACA
GATCACTGGTGCAGGGGGGCTCGCGCTCCTCGTCTGAGTC
ATAGACCCTCCCGACCTCTTTCTCTCGCTCTCTTTCCACA
CATTTCTCTCCATTGCACAACCACTCAAGGAGAAAGTGCT
CCTTTTTTGTGTCGTCACGGATTATAATCAGTCTTTTCTT
TGCTTAGTTCATTTTTGAGGGAATCCCTCAATTCTTCTGA
ACCTACACAGACTGAAACTGGAAGACACAGGGTTGTAATG
CAGTTTTCATTTCATTTCCCCCCCCCCCCCCCCCCGCATC
ATTCCACGCATATGTGCCAGCAGCATCAACTACTGATTTT
CACAGCCATCCTTTTTTTATTTTTCACGCAAACATGCTTT
CTTTTCTTCTGGTATCTCAAGTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations