Transcript

rgs19-201

ID
ZDB-TSCRIPT-090929-22123
Name
rgs19-201
Previous Names
  • rgs19-001
  • zgc:194426-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042399 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042399|OTTDARG00000030587|ZDB-GENE-080723-72 rgs19|OTTDARP00000033724 CH211-86I10.1-001 LG_ CT025851.12 Danio rerio protein_coding KNOWN, 661 bp
GTACACAGGACCTGTCCCGGCAGACCGCGAGTCTCCGATG
ACGCGGAGCGAGACGTCCCCCAGCCGCGCCCAGCACCCCT
CCCCCACACAGAAACCCAACACCTGCTGCTTCTGCTGGTG
CTGCTGCTGTAGCTGCTCATGGAGTGAAGATGACAAGCGC
GGGCGGAGGAAAGCCCAGGAGACAAAGCTGGAGCCCTTTC
CATGGGAAACATGTCCCAAACCGACGATGGAGGAGATTAA
ACAGTGGGCGCAGTCTTTCGATAAGCTGATGAAAAACCCA
GGGGGGCGGAACAAGTTTCGTGAGTTCCTGCGGACGGAGT
ACAGCGAGGAGAACATGCTTTTCTGGCTGGCCTGTGAGGA
CCTGAAGAATGAGATCAACAAAAGTGCCATCGAGGAGAAG
GCGCGTTTGATCTATGAAGACTACATCTCTATCCTCTCGC
CCAAAGAGGTGAGTCTGGACTCTCGCGTGAGGGAAGTGAT
CAACAGGAGGATGCAGGATCCCACCCCTCACATATTTGAG
GACGCACAGCTGCAGATCTACACCCTCATGCACAGAGACT
CCTACCCACGATTCCTCAACTCCTCCGTCTACAGATCACT
GGTGCAGGGGGGCTCGCGCTCCTCGTCTGAGTCATAGACC
CTCCCGACCTCTTTCTCTCGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations