Transcript

zbtb48-201

ID
ZDB-TSCRIPT-090929-21932
Name
zbtb48-201
Previous Names
  • zbtb48-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042194 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042194|OTTDARG00000030463|ZDB-GENE-030131-4450 zbtb48|OTTDARP00000033588 DKEY-7I1.5-002 LG_ CR376748.8 Danio rerio protein_coding NOVEL, 845 bp
TGTTTAGCCCAAATTAAGCATTTGATGCAGTATAATTTAA
CTCTTACTCAGTAAATTACACTACGCGTGTATGTGGATTT
TCGAGGTATAACTGAAATATGGGAGCAACTTTCTAATTTA
CGATGGAGAAACTTGCAGAAGGCTCCTCTCATGCTCAGCG
GGTGCTGTCTTTGCTCAACAAGCAGAGAGCTTTTGGCCAT
TTCTGTGATGCCATGCTGTGCACAGCGAGCGGACAGGTGC
ATCTGGCCCATCGCAATGTCCTGGCCTGCTTCAGCCAGTT
GTTCCAGGAACCCACCTCAAAAACACCATCTATAAAGTTT
GACCTCCCTTTAGAGTGTCCCGATGATGGACTCGAGCTAC
TGCTGAATTTCTTCTACACTGGTGATCTCCAGCTAGACGA
CAGCAATCTGGAAAAAGTCCAAAATGCAGCCAGCGGATTA
TCGGTGCCTGTTTTTCTTATACCCTGCCAGGGTATAAAAA
CTCCTGACCTGAATGAAGGTGATCCATCAAAACCACTGCT
TTCAGAGCCTCAGCCTGATCAGACTCCGAATAAAAAGACT
AGATCTGGACAGAGGACCAAAAATAAAGCTGATGCATTTA
AGTTGAGTACAGCAAGCGATGATGAGCCTCCTGCATTAAA
GTCTACTACTGTCACACGTTCTGGAAGACGTGTAAAAGGG
CCCAGTCGACTGGTTGGTGAAAGTCAAATTTCTGTTGTTA
CCAGACTAGGAGTGGGAAGGAGAAAAGCATCATTTGTAGA
AGACAAAGAGCAGGAGACTGGAGCTACTGAAGATGGAGAT
CATCCCAGACATGAGGATGCAAGTGAGACTACCCAGACTA
CTGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations