header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-21931
Transcript Name: zbtb48-202
Previous Name: zbtb48-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042193 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042193|OTTDARG00000030463|ZDB-GENE-030131-4450 zbtb48|OTTDARP00000033587 DKEY-7I1.5-001 LG_ CR376748.8 Danio rerio protein_coding NOVEL, 2572 bp
GTTTCAACATGGCTTCTTGTTGTTTAGCCCAAATTAAGCA
TTTGATGCAGTATAATTTAACTCTTACTCAGTAAATTACA
CTACGCGTGTATGTGGATTTTCGAGGTATAACTGAAATAT
GGGAGCAACTTTCTAATTTACGGTAAAGATGGAGAAACTT
GCAGAAGGCTCCTCTCATGCTCAGCGGGTGCTGTCTTTGC
TCAACAAGCAGAGAGCTTTTGGCCATTTCTGTGATGCCAT
GCTGTGCACAGCGAGCGGACAGGTGCATCTGGCCCATCGC
AATGTCCTGGCCTGCTTCAGCCAGTTGTTCCAGGAACCCA
CCTCAAAAACACCATCTATAAAGTTTGACCTCCCTTTAGA
GTGTCCCGATGATGGACTCGAGCTACTGCTGAATTTCTTC
TACACTGGTGATCTCCAGCTAGACGACAGCAATCTGGAAA
AAGTCCAAAATGCAGCCAGCGGATTATCGGTGCCTGTTTT
TCTTATACCCTGCCAGGGTATAAAAACTCCTGACCTGAAT
GAAGGTGATCCATCAAAACCACTGCTTTCAGAGCCTCAGC
CTGATCAGACTCCGAATAAAAAGACTAGATCTGGACAGAG
GACCAAAAATAAAGCTGATGCATTTAAGTTGAGTACAGCA
AGCGATGATGAGCCTCCTGCATTAAAGTCTACTACTGTCA
CACGTTCTGGAAGACGTGTAAAAGGGCCCAGTCGACTGGT
TGGTGAAAGTCAAATTTCTGTTGTTACCAGACTAGGAGTG
GGAAGGAGAAAAGCATCATTTGTAGAAGACAAAGAGCAGG
AGACTGGAGCTACTGAAGATGGAGATCATCCCAGACATGA
GGATGCAAGTGAGACTACCCAGACTACTGAGGTGGATATA
TCTGTTGATGACCAAAATGATGACGATGATGATGTTGAGG
ATGCTGCCAATAATGACGATGACAGTGACAGAGGTGGAAG
TGTGGATATTATTATTGAGGGAACTGATGAAGAGTATGTG
CCTCATGATTCACCTTGCTCAAGCACAAAGACTCCACGGG
GAAAACGAAAAGAGAAAAGTAGCAATAAAAAGAATGGGGA
AGGAACGTCAAAAGACAGCAAGAAAGGGGCCGTCCAGTGT
CCAACGTGTCACAAAACGTTTCTCAGCAAATATTACCTCA
AAGTACACAACAGGAGACACACTGGAGAAAAGCCGTTTAA
ATGTGGCAAATGTGGGAAGTGCTACTTTAGAAAGGAAAAC
CTGCTGGAGCACGAAGCCAGAAACTGTCTGACCAGAACAG
AACTGGTGTTTTCATGTTCAAAATGTAGCATGACCTTTAA
AAAGCGGCAAGAGCTGCGTCATCACACAGTCATGCACACA
GGAGTGATGCCCAATAAGTGCACGTCGTGCCCTGAGCAGT
TCATGCAGAAGAGAGACCTCAAGATCCACATGATTAAAGT
CCATGGAGCTCCCAAACCACATGCATGTCCGCTGTGCCCC
AAGTGTTTCCTGTCCCGCACTGAGCTGCGTCTGCATGAAG
CTTCTAAACATCGCGGAGAGAAACTGTTTGTGTGTGAGGA
GTGCGGCCACCGAGCCTCCAGCCGCAACGGCCTGCAGATG
CACATCAAAGCCATTCACAGAAATGAACGCCCTTTTGTGT
GTCAGCTCTGCAATCATGCTTTTACACAGAAAGCCAATCT
GAGCATGCACCTAAGAACACATACAGGAGAGAAACCTTTC
CAGTGCCACCTCTGCGGGAAGACATTTCGCACTCAAGCCA
GTCTGGACAAACATCACCGCACACACACAGGAGAGCGGCC
GTTCAGCTGTGAGTTCTGTGAGCAGCGCTTTACTGAGAAA
GGTCCTCTCTTACGCCACATAGCCAGCAAACACCAAGAAG
GTCGACCACACTTTTGCCAGATCTGCAACAAAACATTTAA
AGCCATTGAGCAGCTCCGGGTTCATGTACGGCGTCACAAG
GGCATGAGGAAATTTGAGTGCACACTTTGTGGTTACAAGT
TCACCAGACAGGCACATTTGCGGAGACACACTCAGATCCA
CAACCGCATGGAAAACTACAGTCCCAGACAGAGGAGATTA
CGTAACCTGGTTGTGGAGGACGCGAGCGCAGCAGCTGCTT
CATCCGGTCTTCCGGTCCAGACAGAGGCTCAGGCAGAACC
AGCAGACATAGTTAGTATAGTTATCCAGCAAGAGGGTGCT
GCAGAAACAGGAGGAGAGCAGGCCTCGTATCCTGTCACTG
ATGGAGCAGTGAATGCTGAACAGACTGGCTTTGCTCTGGC
TGAACGAGAAGATGGAGTCGCGCAGACGGAGTTTACTGTA
GCAGATGTGATGGAGCAGACGCTGCTAGTGCGCGTACAGG
AGGCGTATCCTATACATCAGTCCGATGTGGTGGTGGAGAT
TCCCAACACTGAGGCTGATAGAAAAGACTAAATGAAGGAG
ACTCGTTGACTCCAGAAAAAAAAATAGACAAAAAGACATC
AAGGAATTTGAAGTTATTCAGTGTAAATAAACAGCTTCCA
TGCATGGGAAAACAAGTAAGAAATGCCTTGTATGTTAGAA
AACAATGAATTT

zbtb48 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zbtb48-201 (1)    Ensembl 845
zbtb48-202 2572
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zbtb48-202 Contained in:
[BAC] DKEY-7I1 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000042193 (1),  Ensembl_Trans:ENSDART00000144903 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DV588405 (1) 860 bp
GenBank:DN772440 (1) 784 bp
GenBank:AL717930 (1) 743 bp
GenBank:CK706143 (1) 706 bp
GenBank:CK678022 (1) 465 bp
CITATIONS (2)