ZFIN ID: ZDB-TSCRIPT-090929-21889
Transcript Name: arhgef19-202
Previous Names: arhgef19-001, si:dkey-21o19.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042150 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042150|OTTDARG00000030435|ZDB-GENE-090313-243 arhgef19|OTTDARP00000033560 DKEY-21O19.4-001 LG_ CR925709.5 Danio rerio protein_coding NOVEL, 1535 bp
GAATACAGTGACGTTGCCATCAACAGGGAGATACAGAGGC
AACAAGGGGCAGAGCCAGGAACCGATGAAGAAAGAGGGGA
GTCTGTGTCTCCTGGAAACCTCTCCCCATCCAGCTCATTC
CGCTCATCACGAGGCTCGGCCTTTTCCTTATGGCAAGATA
TTCCTGATGTTCGATCAAGTGGACAACTTGACAATTTCAG
CAATGAAGAGCGTAAACTACAGGAGGCAAAGTTTGAGTTG
GTGACATCAGAGGCCTCATACATACGGAGCTTGTCTATTG
CAGTTGACCATTTTATGATGTCTTCTGAGCTATGCGAGTG
TCTTGGGACACAGGAGAGGCAGTGGCTCTTCTCCAAACTG
CCTGACGTGAAAGAAGTCAGTGAGAGGTTCCTTCAAGATT
TGGAGCGTAGGTTAGAAGGAGACATTTTACGGTTCGACGT
GTGTGACATTGTCCTTGACCACTGTCCTGCACTGAGGAGG
GTTTATCTGCCTTATGTCACCAATCAGGCCTACCAGGAAC
AGACCTATCAGCGACTACTGCAAGAGAATGCCCGGTTCCC
TGGGATCCTTGCCCGCCTGGAAGAGGACCCAATATGCCAG
AGGCTGCCTCTTACATCATTTCTCATTCTTCCTTTTCAAA
GAATCACACGCCTCAAAATGCTAGTGGAGAATATCTTAAA
GAGAACAACGCCTGGGTCACGAGATGAGGACACTGCCACC
AAAGCACTTAATGAGCTCAAAAAGATTATAAAGGAATGTA
ACTCCAGTGTCCAGTCCATGAAGAGAATGGAAGAACTAAT
TCACCTAAACAAGAAAATTCACTTTGAGGGCAAGATTTTC
CCTCTCATCTCTCAGTCTCGCTGGCTGGTCAAACATGGTG
AACTGCTAGAAGTAGACACACAGAATTTGAGTATATCTGG
ATCTAAGTTTAAGCTTACCACCCGGCCAGTGTACCTGCAC
CTGTTTAATGACTGTCTTCTACTTTCCCGAAGGAAGGAGT
CGTGGAAGTTCATGGTGTTCGTACATGCAAAAATTGAAGA
CCTCAAGGTGAAAGACCTAAGCCAGAAACTTCAGGGAATC
TCAGGCTTCATCTTCTATCTGCAGTTATGTGAGGGGCAAC
AGCTAAAACACCAAATTCTGCTCAAATCACCCACAGAGAG
CAGCAAACAGAGGTGGATCACAGCCATGTTTCCCTCCGAT
CCAACGACAGCTATAGAGCAGACCAATGAGAATGATGATC
TATCTCAGGTCCAGTGTATCAGGAGCTACCAGGCTCAAGA
GCATGATGAGTTAACGCTGGAGAAGGCAGACATCCTTCAA
GCTGTAACAATTACAAGTGATGGGTGGGTAGAGGGGATTC
GGTTGTCGGATGGAGAGAGGGGCTGGTTCCCTAAAACGTA
CGTGGAGGAGATCACAAGCCGCAGTGCTCGTTTGCGAAAC
CTCCGTGAAAACATTCGCATCAAGTGTGTCTCACAGAAAT
TAGAGGGAGAGACTCTCTGAGACCTTAAAGTATGGGACAT
TGTTTTACTTTACAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arhgef19-202 Contained in:
OTHER arhgef19-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000042150 (1)
  • Ensembl_Trans:ENSDART00000133269 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT587694 (1) 682bp
    GenBank:CR931404 (1) 539bp
    CITATIONS (2)