Transcript

ano11-202

ID
ZDB-TSCRIPT-090929-21887
Name
ano11-202
Previous Names
  • ano11-001
  • ottdart00000042148
  • si:dkey-21o19.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042148 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042148|OTTDARG00000030434|ZDB-GENE-090313-245 ano11|OTTDARP00000033559 DKEY-21O19.6-001 LG_ CR925709.5 Danio rerio protein_coding NOVEL, 2197 bp
GTGTATGAAATCCTAGCTAGGACTGCGTATGGCAGGAGGA
AGCGTGCAGAAGTTGGAGTAGCTCGTCTGCTGAGAGATGG
GGCTTTTACTGGTGCATTCCCACTGCATGAGGGCCCCTTT
AAGCTCCCAAGTTGTGACACTCAGCCTGACCAGCTGAACA
AGAGACAGGTTCTGTATCACTATTGGGCCAGCTGGTTAAA
ATGGTGCAAGTACCAGCCTTTGGATCACATCCGTGAATAC
TTTGGAGAGAAGATCGCACTTTATTTCGCATGGCTGGGAT
TTTACACCGCCTGGCTTCTGCCTGCTGCATTGGTTGGCAC
GTGTGTCTTTGTTTCGGGTATTTTGACTATGGGATCCAAT
ACTCCAGCGAAGGAAATCTGTGAAAGCGGAGGACTTTATC
TAATGTGTCCTCTGTGTGAAACCTGTAAACCCTGGAATAT
GTCTGACATCTGTCCCATGGCCAAGGTTGGTTATCTTTTT
GATCATCCCGGGACGGTCTTCTTCAGTGTGTTCATGTCTT
TGTGGGCTGTCACGTTCTTGGAGTACTGGAAACGTAAGAA
TGCCACTCTCGCTCACCACTGGGACTGCATGGATTTCCAT
GAGGACGAGGAACCTCCACGTCCCGAGTTTGCTGCAATGG
CCCCTGCAATGGAGGAGAACCCAGTGACAGGAGTGAAGGA
GCCCTACTTCCCTGAAAAAGCCCGGATTTCCCGCATGCTG
ACGGGCTCTATGGTCATTGTTATAATGCTGTGTGTAGTGA
TGATCTTCTTGGTCACAGTCATCATATACCGCAGTATAGT
AAGCGTAATGATGTTCGAAACTGGCAGTTCTGTTCTACGT
ACTCAGGCTGGGAATATTGCCAACATATCCAGCACTTTGG
TGAACCTGGCTCTGATCTTGCTGATGGGGCAGGTCTACAC
AGCCCTGGCAGAACAGCTCACTAAATGGGAGATGCACAGG
ACACAAACACAGTACGAAGATGCCTTTACATTCAAAGTCT
TCATCTTTCAGTTTGTCAACTTTTACTCATCACCTTTCTA
TGTGGCCTTCTTCAAGGGCAGATTTGTGGGCTATCCTGGA
CATTATGGTACATTGTTCGGGATGCGGAATGAGGATTGTG
GACCAGGAGGCTGTCTGATTGAACTGGCTGAGCAGCTCTG
CATCATCATGGTGGGAAAACAACTCATCAACAACATTCAG
GAGTTTGTCATCCCTAAAATAAAGGCTTGGAGACAGAAAC
GGGCCTTGGCGTCTGTAAAGAAAGCCCAGAAGACACAAGA
GCCTGAGCGCTGGGAGCAAGACTATGAGTTGATTCCCTGC
GAGGGACTTTTTGACGAATATCTGGAGATTGTTCTGCAGT
TTGGCTTCATCACTATCTTTGTGGCGGCGTTTCCTCTGGC
TCCTCTGTTTGCTCTGCTGAATAACTGGGTGGAAGTGAGG
CTGGATGCTCATAAGTTTGTGTGTGAATACCGGCGGCCCG
TGGCAGAGCGAGCACAGCATATTGGTGTCTGGTTCATCAT
ACTGGAGGCGCTGTCCCACGTGTCTGTCGTAGTCAATGCA
TTCCTCATTGCGTTCACCTCAGATTTTCTGCCCCGTCTTC
TGTACCAGTACAAGTTCAACAATGACCTCCATGGATATGT
CAACTTCACACTGGCTTATTCTCCACCCAGTTACAATCAC
TCCAGTCATACTGTGTGCAGGTATAAAGCATTTCGGGATG
AAAATGGGAAATATAAGCTGGTGTATTGGGAGCTCCTGGC
TGTAAGACTGGGATTTATTATCGCCTTTGAGCATGTAGTG
TTCTTCGTTCTGCGTGTGATTGACTGGATGGTTCCTGATA
TCCCTGAGTCTCTGCAGCTGAAGATCAAGCGTGAGCGTTA
CCTGGCTAAACAGGCTCTGGCTGATAACCAGGAGGCCTTG
CTGCAAGCGAAGCGTCTCGCTACATGAGACTGACCTGCAG
CTCAAGTGTTTCTCCAGAAGGGGGCGCTACAAAAACACTT
TCAGAACTGACTGTTTTGAACAAGAAAAGGAAAAGAAATG
CTGTTGGACTGAATTTTGGCTTGTGTTTTGTGCCGGTTGA
TGGTGTGAGGGTGTTTGTAAGCATGCATTTCACAATGAAG
AGGTGTATGCCAAACTCCGTTCTCTATCACCTCTACTTTA
ACCAACGGCTGTTTACATCTGACTTCCTCTGGCTCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations