Transcript

ano11-203

ID
ZDB-TSCRIPT-090929-21886
Name
ano11-203
Previous Names
  • ano11-002
  • ottdart00000042147
  • si:dkey-21o19.6-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042147 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042147|OTTDARG00000030434|ZDB-GENE-090313-245 ano11|OTTDARP00000033558 DKEY-21O19.6-002 LG_ CR925709.5 Danio rerio protein_coding NOVEL, 803 bp
CTCCTCCGCTTATAGAAGCACTTAGTGCATTTCCTCTGCT
GTAGCTCTTCTATGGCTGAAATGCACTTACACTTTTATCT
CAAATTTAATTTATGTGCATAATTTATTGGACACTGATGT
TCCGCAGGAGTGCCTGGACTGGAACGTTGGGACTGTGTGC
ATACAGTACAGCAGAAGCCCTGTTAGCTCCACCTGTCTGA
AATCCTCATGAAGAGGAGGAACCCTGAGGTGCTGATGGAC
CGCGAGGTTCTGCTGGATCTGGACTACGCCAGCGAGGCTC
ATGCTCCAGACAGTTATGGGAGCCTGCAAAATGGGGGCTT
CATCCCTCCCAGATATTTGAATACTGCAGCCAATGATGAC
GATGACCCCATATACGTTCATTGTGAACAGACCGCAAGCG
CACCTGTTCACCATACAGGCAACTACTTCAGAGACGGCCA
AACAAAAATAGACTTCGTGCTGGTGTGGGAGGTAAAGGTT
CGCCGTAAGCGCAGAAGTCGAGGACAAGCAGAGGCGTCCG
AGGGGGCAGCAGAACCAGCACAAGAGGAGAGCAGGTCAGA
GAGAAGAAAAGCTCAGCTGGCCAGATGGAGAGACAAATTC
ATCCTGAACCTCCAGACTGCTGGACTGTTGATGGAAAAGG
AGGAATCCTCCAGTGTAAAGAAGACTATCCACTATCTGAA
GCTTCATGCTCCGTGGGACGTGCTGGTGTACTATGCTGAG
GAGTTGTGTTTAAGAGCTCCTCTACAGGCACAGCCTCATC
CAGACTTCAATACTTCTGCTCGAGTTCTACAGAAGCTCTG
GGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations