Transcript

atp1b1b-201

ID
ZDB-TSCRIPT-090929-21702
Name
atp1b1b-201
Previous Names
  • atp1b1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041907 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041907|OTTDARG00000030292|ZDB-GENE-001127-4 atp1b1b|OTTDARP00000033405 atp1b1b-001 LG_none CU915827.5,CU468726.9 Danio rerio protein_coding KNOWN, 2279 bp
GAATTCGCTGCTCAAGTGGACAAACAAAACCTTACAGTAC
ACCATGCCCGCTCAAAATAAAGACGACGGAGGATGGAAGA
AGTTTGTATGGAATTCGGAGAAGAAGGAATTTCTAGGACG
TACCGGCGGGAGTTGGGCAAAAATCTTCCTCTTCTATCTC
ATCTTTTATGGCTGTCTGGCCGGGATCTTTATCGGCACCA
TTCAGATTCTCCTCCTCACCCTGAGCGATTACAAACCCAC
CTGGCAGGACAGAGTCGCTCCTCCAGGTCTCACTCATTTC
CCACGTTCAGACAAGTCTGAGATTGCCATTAACCTGGATG
ACGAGGTGTCGTTCCTGAACTACGTCAAAGTCATGAGAGA
GTTTCTGACATCCTACGACCAGGAAAAACAGTTAGACAAT
ATGCAGTTTGAAAACTGTGGAGAATCACCCTTGGACTACA
AAAACAGAGGTGATCTGGAGAGTGACGTTGGGGTTAGGAG
GGCCTGTCAGTTTTCGAGGGAGTGGCTTGGACCCTGCTCT
GGCCTGGACGACCCTTATTTTGGATTTAAGGAAGGGAAGC
CCTGCCTTATTGCCAAACTCAACAGGATTGTGAACTTCAG
ACCTAAGCCACCAGTATCAAATGAAAGCATTCCGGAAGAG
GTTCAGCACAAAGTCCAGCCCTATCTTATTCCCATCCACT
GCACAAATAAGAAAGAGGAGGATGCAGGTAAGCTGGGTGA
GGTGAGGTACTACGGTTTTGGCGGAGGCTTCCCTCTTCAG
TATTACCCCTATTACGGCAAACTTCTGCACCCTCAGTACC
TGCAGCCGCTGGTGGCCATTCAGTTCCTCAACATCACTCC
CAACACGGACATGCGCATCGAGTGCAAAGTGTACGGGGAA
AACATTTATTACCACGACAAGGACCGCTACCAGGGACGAT
TCGACGTTAAATTCAACATTAAAAAATCATGACCTCAAAA
CACTACCTCCATTCTCTCCCTACTGAAAGGCAAACTAAGG
CCCCTCTTCTGACTTGAGATACAGAGAGAAGTTTCTCACC
GGTCTTCCACAGCGTTTAACCGAGGAGATGTGTCTTTTGT
TTTGTTTTTTCCTGAATGTACAAAGTGTCTCACGTCAGAA
AGAGGCCTCATTTTAGTTCAGGAGAGATTAAGTCAAAACA
AACAAATAATTAAAAAAGTGAATAAACATGATATATACAT
ATATACACACACACATATACATACAGTGAGCAAAAAAGTA
TTAAACATGTCACCTTTTTTTCTCAGAAAACAAATTTCTA
AAGATGCTGTTGACTTGAAATTTTTCTTAGACGTCAGTAA
TTTACATTCAAAGAAAATAAAACTAATTAATTTAGAAATA
AAGTCACGTGTAATAAAATGAAATGACATAGGGAAAATGT
ATTGAACATATGAAGAAAGGAAGGTGCAAAAAACGCATGG
AAAGACCAGACAGCAGCTCAAATATCTGCTTCTACATTCG
AAATTGCTAACTTTCCCTTTTATGTAGTATGTGAAAAACA
GTATTGTTCACCAAGTAGTATGTCCGAATTTAGAGTTTTC
AAAAAATACCTAATGTTTCCCGTGAAATTCCAGTGGATGC
TACACTGTAATGCCTTTAATGCCACATGAGAGAATTCATG
AATGGGAGGAAAGTGAAGTGACGCAACCAGGGTTTAATTT
GGGCTGGAACAAGCCGGATCCGGAACCTCATTTTAGCCAC
CTATACCCACCATGGCCCCTGGTCAGAATATAAGCTGTTT
CAATGCCAACATCTGCATTACCAGGGTGGACATTTCAGCA
AGACAATGATCCCAAACACAGACAAGCTGACTCTCAATTG
GTTTCAAAAAAGAAAATAAAGCTGCTACAATGGCTTAGAC
AATCACCTGACCTGAACCCAATGCAGACATATAGACGAGA
CCCACAGAAACGTCAAGATTTTTACACTCTGTTGAAGTCT
AAAAAAAACTAGCTAAGCAATGGATACAACTCCATTCTCC
ATACAAGAGGTGTCTTAAATAAAAAAGGTGTCTTGCCCCC
CCTCAAAGTATTTACAAAGTATTAAATAGATTTCAGAAGT
TCATTACCTTCTCCTTGTGTAATTACACAAAACGTTATTT
CTGAAATTTATTTTTGGAAGTTTGGATTGTTTGGGGTTTT
GACCAAAATCTGAGTCAATTTCACGTCAACAGCTCCTTTA
GATATATATTTACCAGGAAAAATCATGACTTGTTTAATAC
TATTTTTACCCGCTGTATATATACACAAAAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations