ZFIN ID: ZDB-TSCRIPT-090929-21661
Transcript Name: chrna6-201
Previous Names: chrna6-001, si:dkey-234d14.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000041813 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000041813|OTTDARG00000030234|ZDB-GENE-090312-91 chrna6|OTTDARP00000033349 chrna6-001 LG_none CT025656.8,CR376846.9 Danio rerio protein_coding KNOWN, 1937 bp
AAATCCGCCTCACGCGCTTTCTGCTCGCGCAGAGCTCAAC
TCAGGCGCACCAACGGGACCCAAAAACATATTTTCTACAG
TTTGTTCCTTCTTGATTCGTACACGAATTTGCTACTTTGT
TTTGGAAAGGGAGACGGTCTCCCTACCTGCGACGTCCGAT
GAATTCTGCGGGGAGAGTCACTTTGTTTTTTCTTTTAATT
GCCCTGATAACGCAAGATTGTTTCTCGTCTAAAGGAGAAG
ACAGGCTCTTTCGTCGTTTATTCAGGAGGTATAATCAGTT
CATTCGGCCAGTGGAAAATGTGTCTGACCCTGTTACTGTG
GAGTTTGAGGTCTCCATCTCACAGCTTGTTAAAGTGGATG
AAGTCAATCAGATCATGGAAACAAACCTTTGGCTGAGACA
TATATGGAATGACTACAAGCTGAAGTGGTCACCAGCAGAG
TTTGATGGAATTGAGTTCATCAGAGTCCCATCCAATAAAA
TCTGGAGGCCTGACATTGTACTTTACAACAATGCTGTTGG
GGACTTCCTGGTGGAGGACAAAACCAAAGCCCTTTTGAAA
TTTGATGGAACCATCACTTGGGTCCCACCTGCAATTTTCA
AATCTTCCTGCCCTATGGACATCACTTACTTTCCTTTTGA
CTATCAGAACTGCTCTATGAAGTTTGGTTCCTGGACGTAT
GATAAGGCCAAAATTGACCTGGTTCTTATCGGCTCTAAGG
TCAACCTTAAAGACTTCTGGGAAAGTGGAGAGTGGGAGAT
CATTGATGCACCGGGTTATAAGCATGACATCAAGTACAAC
TGCTGTGAAGAGATCTACCCAGATATAACCTACAGTTTTT
ATATACGCCGACTACCCCTCTTCTACACTATCAACCTTAT
AATCCCCTGCCTCCTCATCTCTTTTCTGACAGTACTGGTT
TTCTACCTTCCGTCAGACTGTGGCGAGAAGGTGACCTTGT
GCATCTCTGTACTTCTATCTCTCACTGTGTTCCTTCTTGT
CATTACGGAAACCATCCCATCTACTTCACTTGTGATCCCT
CTGATTGGCGAGTACCTTCTCTTCACCATGATCTTCGTAA
CCCTCTCTATTGTTATCACTGTCTTTGTACTGAATGTGCA
CTATCGCACCCCTATGACCCACACTATGCCCAGCTGGGTC
CGCACTGTCTTTCTTCGAGCTTTACCCCGCATCATGCTCA
TGCGCAGGCCTCTTGATCTATCAGAGTCCTCTGGAAAAGG
AGGACTAGAAACTGGGGGCTCGTCCGGGACAGGAGCAGGG
CGCGGAGGAGAGGGGAAGAAGAGAAAGAATAGTGGATCCC
AACAGGGTGCAATGAACTCTCTGGAATTTGGAGAGGGGAA
AGCAGCATTGGAAGGAAAGAAAGGAGGATGCCCATGTCAT
CCACTGAAAGAAGCAACTGAGGGAGATTGTGGGAAAGTCA
GCCGTCAATTAAGTCCACAGGCTATTAATACAGTTGTGGC
TTTCTCTGTCGTGTCACCGGAGATCAAACAGGCTATTGAA
AGTGTGAAGTACATTGCTGAGAACATGAGGAGCCGCAACA
AAGCTAAAGAGGTGGAGGATGATTGGAAGTATGTTGCCAT
GGTGATTGACCGCATCTTCCTCTGGGTCTTTGTGCTGGTG
TGTGTGTTAGGAACTTTGGGCCTCTTCCTGCAACCTTTGA
TTGGCTTCCTCTCGTAATTAACTATGAAACACTAACCAAC
AATTTTCTGAGTCACTGACATGCTCCGTATTTATTAATGT
CACATGTTCCGTCACTACATCAAGACTCTGATAATATAAA
CTATACACAGGTGCCCTTGTACAGCAAATATCCAATCAGT
TTTCCTCTGCCACTAATCACTTGGATGGTTAAAGGCTGAT
TTTGGCCTTTTAACAATCATTGACTTTGAAACTTGACTAT
AAGTGAACCTTCCAATC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
chrna6-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000041813 (1),  Ensembl_Trans:ENSDART00000031546 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DQ822507 (1) 1940 bp
GenBank:BC171403 (1) 1803 bp
GenBank:BC171405 (1) 1803 bp
GenBank:AL924878 (1) 500 bp
CITATIONS (2)