header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2158
Transcript Name: ptpn22-202
Previous Names: ptpn22-001, si:dkey-78k11.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000012204 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000012204|OTTDARG00000010574|ZDB-GENE-060503-458 ptpn22|OTTDARP00000010497 DKEY-78K11.1-001 LG_ AL845287.10 Danio rerio protein_coding NOVEL, 585 bp
ATCTAAGCGTTGACCACAGAACTTGTGAACTGCTGCAACC
ACTGCTTCCGTAACGACATCAGTTCCTCAACTCAACTACA
GCCCAAAGACAGACGCACGCAGAAAGAAAGTGAAAGATGG
GCTCCTTTCTGAAATCCACCGATCTCCCGTTTCTCTGATA
TGACAGAGGAAGCTGCTGTCTCACACATCATGCCATGGAC
GCCCAAATGCACATTCTGAGGAACCAACTGGATCTAATCG
CCATCAAGGAAGCAGAAGATGAAACGGCAGAGAACGGCTT
TGCCGGGGAGTTTTTGAAACTGAAAAGGCAGTCGACTAAA
TATCGTGCGGAGAGGACGTATCCCACCACAGCTGCAGATA
AACAAGACAATGTGAAGAAGAACAGATATAAGGACATTGT
TCCCTTTGATCACAGCCGAGTGAAGCTCTCCCTCTTCACA
TCTAAAAATGACACGGACTACATCAATGCTAGTTTCATTA
AGGGTGTTTCAGGCTCTAAAGCATATATTGCCACCCAAGG
GCCACTGTCAAACACTGTGCTTGACTTCTGGAGAATGATA
TGGGAATACAACATAAAGGTAAACG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptpn22-202 Contained in:
[BAC] DKEY-78K11 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000012204 (1),  Ensembl_Trans:ENSDART00000165046 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CB358511 (1) 578 bp
GenBank:CD586243 (1) 500 bp
CITATIONS (2)