Transcript

si:dkey-28b4.7-002

ID
ZDB-TSCRIPT-090929-21485
Name
si:dkey-28b4.7-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041433 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041433|OTTDARG00000030053|ZDB-GENE-050506-118 si:dkey-28b4.7|no_translation DKEY-28B4.7-002 LG_ BX511158.5 Danio rerio protein_coding NOVEL, 430 bp
TAAAAGGCTTTATTGATGAAGACTGCTGCTGTCAACATTT
ACAAATAATTTATCATATGACGATATCCTATCAGCGTCCA
GATATGACACCAAAGCGTGGCCTCATCACCGACACCTTTA
AGGTTGTGAAGAAGGCAAGGAGAGGAGGCAAGAGAAGCAA
GTCTCCTTCACCACCGAAAGCAGGTCAGATAGTATTTTGT
TCTGTGTGTTAACATGCATCTTTAAGCAGAAATCATTCCA
TATCACTATGGTCCTAAAGTGTGCAAATGCTTTAGAGGCA
CATGCAACCATGTAATGCATTTATAACCTGTTATTACTGC
TCAGAGCCTGAACCCCCACAACTGAGTGAAAGAGAAAAAG
ATATACAGGAGCTGAAGAACTTTGATCTGGATTGGAAGTT
TGGACCATGCACAGGGATCAGTCGACTGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations