Transcript

si:dkey-28b4.7-201

ID
ZDB-TSCRIPT-090929-21484
Name
si:dkey-28b4.7-201
Previous Names
  • si:dkey-28b4.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041432 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041432|OTTDARG00000030053|ZDB-GENE-050506-118 si:dkey-28b4.7|OTTDARP00000033094 DKEY-28B4.7-001 LG_ BX511158.5 Danio rerio protein_coding NOVEL, 605 bp
AGTGTGCGTGGCTCAGCCCTGCCTATCGAACGTCAGTCTG
TTTTGTAAACGATCGAAACACAAAGGGAAAGTTAAAAGGC
TTTATTGATGAAGACTGCTGCTGTCAACATTTACAAATAA
TTTATCATATGACGATATCCTATCAGCGTCCAGATATGAC
ACCAAAGCGTGGCCTCATCACCGACACCTTTAAGGTTGTG
AAGAAGGCAAGGAGAGGAGGCAAGAGAAGCAAGTCTCCTT
CACCACCGAAAGCAGAGCCTGAACCCCCACAACTGAGTGA
AAGAGAAAAAGATATACAGGAGCTGAAGAACTTTGATCTG
GATTGGAAGTTTGGACCATGCACAGGGATCAGTCGACTGC
AGAGATGGGAGAGGGCAGCACTGCATGGGCTGAATCCCCC
GCAGGAGATTAAAGACATTTTGCTGAAGGAGGACACTGAC
CCAGAGTACACACAGAGTCTCTGGCGTGACTATCCTTTCT
GACAAACAGATGGAGAGTGACAGAAACGGAAGGAAAAAGG
AAAATAGTTTTGATATGTTCTGCTATGTTTGCTTTGCTGT
TTACTACACTACATTTTATTAAACATTTGTATGCAAAAGC
TTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations