Transcript

dok7-202

ID
ZDB-TSCRIPT-090929-21420
Name
dok7-202
Previous Names
  • dok7-001
  • ottdart00000041366
  • si:dkey-180b4.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000041366 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041366|OTTDARG00000019446|ZDB-GENE-090312-103 dok7|OTTDARP00000033045 DKEY-180B4.3-001 LG_none BX511116.4,AL954671.8 Danio rerio protein_coding NOVEL, 2948 bp
TGCATGTGTGAGTATTGTGGGGGAGAGAGAGTTTGCGTGT
GTGTTACAGCAGAGCAGACAGTGAATTCTGGAGGTTATTT
TGAAAGTGACCCCCTCACTCACTCACTGCCGCGGACCGCA
CACAGCTGTCGGGAAACATGACACAAGATGACGGATACGG
TTGTCGTAGAGGGACAAGTCAAACTCCGAGAAGGCAAAAA
GTGGAAAAACAGATGGGTGATTCTTCGGAAACCTTCGCCG
GTAGCAGACTGCCTGTCCTTGCTGGTGTATAAGGAGCGGG
GAGAGAAAAGCAAAGGACAGCGAGAGAGGAATCAGGCCAC
ACTGAGGGATATCTGTGGACTGGAGGCTCTTCAGGGCTTT
GATGGAGTAAATTATGCTCTCAGTCTGCTCTGCCTGAGCC
AGTCTGTCATGCTGGGTTTCGACAACAGAGTGTCTCTTCT
GGCCTGGGATGCTCGGATCCGCTACAGCCTTGGAGAGGTT
CACAGGTTCAACGTCAACATCCAGCCTGGCACCAAACTAG
AAAGTGGCCCGGCCTCTTTGCATTTGTGCAACAACCTGCT
TGTCGTTGCCAGAGACCTCCCTCCAACCGTCATCGGCCAA
TGGAAGCTGTCGGATCTAAGACGTTACGGTGCCTTTCCTA
ATGGATTTGTCTTTGAGGGCGGGACAAGATGCGGCTACTG
GGCCGGGGTTTTCTTTCTTGCGTGTGCAGATGGAGAACAG
ATCAGTTTTTTGGTGGATTGCATCGTTCGTGGCATTTCGC
CAAGCAGAGGGCCGTTTGGACTGCGGCCAGTCCTGCCAGA
CCCCAATGCTAACCCGTCGTCTATAGAAGACCGGATTAGC
CAGGAGGCTAGTGAGCTGGAGAAAAGACTCAGCATGCTGT
CCATTTGTAGTCACCACAGCAGTGCAGCCTCCACCTTCAG
TTATGGCGCCTCTTTGGCAGGAGATGATCGAAGTATCTCC
AGCTCGTCCTCTGAGGCCAGCCATTCTGATAACAGCTTGG
GCAGCCGCCTGGCGATCTGGCCGGAGCCAGTCAGACACCC
CACCCCTGTCGAACCACCACCGCCACCACCATCATCATCA
TCATCATCTCATTTATTGGTTACAGGATGTAAAAGCACAG
CCTGTTCAGTCAGTACGTCCAGTGACGAGCGCATATATGG
AGTTATGATGGGTGGACTTCGCCCCCCGTCCAAACCCCCT
CACCCTAGGGGCCTTCAGGAGGCGGGACGGCAGAGCTCCA
CAGACAGCGGCATCGCCACCGGAAGCCACTCCTCATATTC
GGGAAGCTTCTCCTCTTACACTGGGAGCATGGATATTGGC
CATGGAGAGACTGACGAGTTTGGATCCTTAATAAGCCTTC
CTCAAAACCCCAATTCAGTCTCTATTATAAACACTCCAGT
AAGGACAGTTCCCCAGATTCCTGAGGACAACCCATGTGTG
TGTTCTCTCCGAGAGGCTGATCAAACACAGGCCAACGTAT
ACACAAGTTCACCTCTGCAGCATTACGATGTCCCTCGCAG
GTTCCTACAACACAATCAGGAGCAGTGTTCCACTGGTGTG
GTTCAGGACAGAGGGTCTGAATGTGGAGCGGAGAGTGTCC
CTGCTGACAACGTCATAAGACAGACTGTCCTGAGGAGATT
GAACTCTTGTGGAGTAGACGCAGTGCCACCTGAAGGTCCC
ACCACAACACGCTTACAACCCATCATCTGTCCTGACTGTG
GCGGACGAAAGGTGGAAGAGAAAAGCCGTTCTGAGCAGCA
GAAGACTGATGCAGATCCAAAAGGCAATTATGAACAGATG
GCATTGATGAGTGATTTGTCCAGGTGGACACAGTTCAGAG
CCGGAGAGTATGGTAATTCACATGCCCTCATTTCATATAT
CTCTCCATCGGATCATAGCATTTCGTTACTATCTGTGTAT
GAATCTGGTTTCTGCTGTGGTCTTACAGGAGAGGCCGGAC
TGACAGTCACTGACAGAGCTCAAGGTGATTCTGTAAATTA
TGTTAACATCCCCATCAGTCCTACATCTAAACGACAGCTG
CACTATATGGAGCTGGATCTGCAGGACCGTCCTGAATCAA
GCCACACTATCAGAGCGGCTGGCTCCAGCACTAAATATGC
CCACATTGACATCACTGCGACAGAGACGGCACAGAGGGTT
GGTGCCCAGCATGCACAGGGCAGAGAGGATAGACTGCTGG
AACTAGAGCACAAGAGGAGAGGAACACTCACATAAACACA
CAAAGTATTTTAATATGATGAGGATTTTTCTCTCCATTCA
AGCCCAGAAATATTTGTATTTTTTACTGTAGAGATTTAAG
GGGGGAGATGATTCTTTTAATTTCTTCTTTTGACATTTGG
ATTTTAATAATAAATAAACTTTAAAAAGATAAAAGCATAG
ATCTAGTATAGAATATTTAACCTGCAGCCATGTACCTGGA
AATGTGGCACCACTTTTCATTTTTTTACATTTAAAAATAT
TCTTGATGTCTTTTTTTTAAATTCTGTCAAAATTGTTTGC
AGATTAAATTTTTTTCTCTCAAACTTCCATGAAACACATC
ATCAGCTTTTAAACACATTTTCAAACCCTGATCTACAGAA
AACAGTTATTTTATAAGAAATTCATTCTTCAGGCATTTTT
TCTTAAATGTTTTTACTCATTGTGATGCTAAAATATGTAA
GTTAAATGCAAAATATAATCGCTTTTATAAGTGATCTCTT
TATGGTTCACTATATATATATATATATATATATTTATCAG
TGGTTCTAAATATTATTTACCTTATAAAGTAATCATCCTA
CACAACCAAAATGGAAAGTGAAATGCAGCCTTCCAAAAAT
AAGATGTTTTTATTTATTTATATAAAATTAATCAATTTGC
AGATGTGACTGACAGTGTAATGTAATGTAATGTGTATTTA
TATAGCACATTCATCGTGTATCATCCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations