Transcript

dok1a-002

ID
ZDB-TSCRIPT-090929-21418
Name
dok1a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041364 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041364|OTTDARG00000030006|ZDB-GENE-080721-2 dok1a|no_translation CH211-89O9.5-002 LG_ BX511019.6 Danio rerio protein_coding NOVEL, 546 bp
TGGAGAAAACATGGCCGCTTTTTGTGTGGAGACCGAGGAG
AAGAGGCTGGTGTTCGCAGCAGAGAGAGAAAGCTGTGGAG
AATGGGTGAATATCATATGTAACATCGCCTTTCAGAAACA
AACTAAAAGTGCTCCACTGCCGGTACCACATATGGAGGAT
AATCAGATCTACATGTCTAGAGAACAATTGTCCGAGTTCA
AAGTGGTAGTGCTACAAAGCGATGCTTCAGTCCGCTGTGG
CCTAAAAGGACAGTACTGGCTGCAGACAGGTGAAGATATG
CTGCTTATACAAGATCTGGACACCAGGAGGACAGTGATGG
AGTGGCCATACAAGCTACTGCGCCGTTATGGTCGAGATAA
GGCAAGTAGAGAAAAATATGTAGTAACACTTTAATATGGG
ACCAAGGTTATTTTAGTAAACAAAAACTAAGCTATTTTTT
TTTTAAATTTCACAGTTTTTTTTTTTTAACTAAAATCAAA
TGAAACTGAAATAAAATAATATTCAGGATTTTCTAAAAGA
ATCTCCTGTAGATCAGGAGAAAACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations