Transcript

dok1a-201

ID
ZDB-TSCRIPT-090929-21417
Name
dok1a-201
Previous Names
  • dok1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041363 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041363|OTTDARG00000030006|ZDB-GENE-080721-2 dok1a|OTTDARP00000033043 CH211-89O9.5-001 LG_ BX511019.6 Danio rerio protein_coding NOVEL, 1617 bp
GGTAATATGTGTTAACAGTTTTAAGAGGACACACATTATT
CTAGAAAAGGATAAACCTTTTTTGAAGTATTTTTCTGAGC
TCACAGATATTAAGGAGACCGACATGGAGACACATGGGAA
ACAAGGTGAAGTTTTTCTACAACACCAGAAACATGGTGAG
AAGTGGAAGAGATATTGGTTGGCCCTTCATCCGGCCAGTC
GGCACGGTATTGCACGGTTAGAGTTGTCAGAAGCTATTCA
AGAACGGTCAACTGTGGTGGTCAGACGGCATCCAGAAAGG
AAGGTCATCCGTCTGGCTGACTGCGTGAGTGTTGTTAAGC
TGCCTCCTCATGCAGAGGCTTGTCCTGGAGAAAACATGGC
CGCTTTTTGTGTGGAGACCGAGGAGAAGAGGCTGGTGTTC
GCAGCAGAGAGAGAAAGCTGTGGAGAATGGGTGAATATCA
TATGTAACATCGCCTTTCAGAAACAAACTAAAAGTGCTCC
ACTGCCGGTACCACATATGGAGGATAATCAGATCTACATG
TCTAGAGAACAATTGTCCGAGTTCAAAGTGGTAGTGCTAC
AAAGCGATGCTTCAGTCCGCTGTGGCCTAAAAGGACAGTA
CTGGCTGCAGACAGGTGAAGATATGCTGCTTATACAAGAT
CTGGACACCAGGAGGACAGTGATGGAGTGGCCATACAAGC
TACTGCGCCGTTATGGTCGAGATAAGATGCTGTTTTCTAT
AGAAGCAGGCCGACGCTGTGAATCAGGTCCAGGGACCTTT
AACTTTGAGACCCAACAGAGTGAAGAGATCCTTCGCCTCA
TTGAGTCTGCTATTCGCCAACAGAAGAGCCTCAGTGTTGC
TAGAGAGAGGCACTCGCCACATTCTCCACGCTCTCGTTCT
CCTCGCTCCCCCCTGCCCAAACGCCCTGAAAGTTTGCTTT
CGCTTGACGCAGAGGGCAACAGCAGCCCTAATTCAGCAGA
TGCCCTCGGTCCAAACTTCAGCCCCATCTCAAATCCTGCA
CATATAAAACCTGCAAGTCCTATTTGCTTAACCGAAGTTG
TGTATGCAAACCCTGCAGATTCCCTAAGATCATCACAAAT
GACGCACTCGGATCCTGCTGACTTGATTGAGCCTGTGTAT
TCAAGTCCCACAGTTTTAATAGGCAAGCATGAGCCTGTGT
ACGCACAGCCAGATCTCATTAAATCTCTTCATTCTTTAAA
AGACGATCCTCTCCCAACTCCTTATAAAGATGAGCCAGTG
TATTCTGACCCGGTTGATGTCATCCGCCCAAAAGCCAACA
CTTGTGTTCAGGCCAATCCTACTAACACAACAGACATTCA
ACCTAAAACAGTGTCAAACAATGTCAAGCATCCAGAACCT
GTATACTCTGAGGTGTATGACCACATTGCACTAATCTCCC
GTAAGAAAGCTGACCAGACGTTTGAGGAGCCCATTTATAG
TGTGCCTGAAGTTGTAAAGTCAACTCAAAACAATAATTTG
CAACAAAACAAAATGCCTGAGGAGCACCAACCTATCTACA
GCAAAGTCAACAAACCACCCAAAACTCCTTACAAAGATAA
GAAGCCAAGCCTAACGTCAGAAATTGTCTCTGAGGACCTT
GGACTAATTTAATTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations