ZFIN ID: ZDB-TSCRIPT-090929-21412
Transcript Name: cyp2u1-201
Previous Name: cyp2u1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000041358 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000041358|OTTDARG00000030003|ZDB-GENE-070730-1 cyp2u1|OTTDARP00000033040 cyp2u1-001 LG_ BX572104.6 Danio rerio protein_coding KNOWN, 1708 bp
AAGATGTGTTTGATCAGCAGATAGCGGTTATTGATTAGGA
GGAACTATGCGTCTGTTTTAATCCATCAGTGGATTTGAGA
AGTGCGCCAGTCATGGACGTATCAGCGGGTCTGTTGTTAG
AGTATGTTTTCTCGCCTGCAAACATAGCAGGTTTGATAGC
GTTCGTACTGGTTTTCTATGTGCTGCAAGAGTACCAGTGG
CATCAGACATACGCCAACATCCCTCCGGGTCCAAAGCCAT
GGCCCATCGTGGGCAACTTCGGGGGCTTCCTCGTGCCACC
TTTCATTTTAAAACGCTTCGTGAAGAACAGCAAAGAGTTC
GCGAAGGTGGTGTCGAACCCGCTTTCTCCTCAGGCTGGAC
TCATAGAGATGTCCAAACTGTACGGGAACATATTCAGCAT
TTTCGTCGGGCCTCAGCTCATGGTGGTGCTGACGGGATAC
GACGCGGTGCGGGACGCGATGCTCAACCACACGGAGACGT
TTTCTGACAGACCGCACATACCGCTCGTTACTATTATCAC
CAAGAGGAAAGGGATTGTATTTGCGCCGTACGGCCCGCTG
TGGCGAACCAACCGCCGGTTCTGTCACAGCACTCTGCGCA
GCTTCGGCTTCGGCAGGATGAGTCTGGAGCCCTGCATCCA
TGAAGGCCTGGCCATCATCAAAACCGAGCTCCAGAGCCTC
ATCGAGACAGCAGGCCCTTCTGGCATTGATCTGACTCCGC
TCATCAGCAATGCGGTCTCCAACATCATCTCCTTAATGAG
TCTGGGTCAGCGCTTCCACCATGAGGACAAGGAGTTTCGA
AACATGCGGGATCTCATGTCCCACGGCCTGGAGATCAGCG
TCAACACCTCCATTCTGCTGGTCAATGTGTTCCCCTGGCT
CTACTATCTGCCATTCGGTGTCTTCAAGGAGCTGCGACGA
GCCGAGCTTGACATTACAGCCTTCCTGAAGAGGATCATCG
CGAGGCACCGAGCCACACTGGATCCGGAGAATCCCAGGGA
CTTCATCGATATGTATCTGGTGGAGATGCTGGCCAAGCAG
AAAGAAGGCAGTTCAGAGGAAAACCTGTTCTCCGAGGATG
ATCTCTTCTACATTATTGGAGATCTCTTCATTGCAGGAAC
CGACACGACGACTAATAGCATGCTGTGGAGCATTCTCTAT
ATGTCTTTGTATCCTGATGTGCAAGAGAAGGTTCAGAAGG
AGATTGATGCAGTGGTGGGATCTGAGAGAGTGCCCTCTCT
GACCGATAAGAGCAGTTTGCCGTACACTGAAGCCACTATT
ATGGAGGTGATAAGAATGACTGTTGTGGTTCCTCTGTCCA
TACCACATATGGCCTCAGAAACCACCGAGTTCAGAGGGTT
CACCATCCCTAAAGGAACGGTTATCATCCCAAACCTCTGG
TCAGTTCACAGGGATCCCACAGTGTGGGAAAATCCTGATG
ACTTCAATCCATCACGATTTCTAGATGACCAGGGAAAGAT
TCTCAGGAAAGACTGCTTTATTCCATTTGGATTGGGGCGC
AGAGTGTGCATGGGAGAGCAGCTGGCGAAGATGGAGCTGT
TTCTGATGTTCACCAGCCTGATGCAGACCTTCACATTCAG
GTTTCCAGAGGGAGCAACTGCTCCTTCCATGCACGGACGC
TTCGGCCTGACTCTGGCTCCATGCCCGTTCACTGTCTGTG
TCAAAACACGCTGAACGGGGCTTTAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyp2u1-201 Contained in:
[BAC] DKEY-5K4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000041358 (1),  Ensembl_Trans:ENSDART00000048281 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DN771702 (1) 795 bp
GenBank:EB945506 (1) 586 bp
CITATIONS (2)