ZFIN ID: ZDB-TSCRIPT-090929-21403
Transcript Name: dkk2-201
Previous Names: dkk2-001, zgc:171574-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000041347 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000041347|OTTDARG00000029997|ZDB-GENE-080204-14 dkk2|OTTDARP00000033031 dkk2-001 LG_ CR855327.11 Danio rerio protein_coding KNOWN, 1357 bp
AACGCCAGCTTCACCAACACTCACACGGGCACGAGTCCTC
CTCTCCTCTCTGCTGCTCTGATTTTTTTTCTCTTAGTGCA
GCATCCTGGTGCCTTTTACATTCCTTCAGTTTTTTGTGTA
TTTTAAATTGTATTGCATTTCAAAGCTCCTCTGCAACAGC
TATATACTTTTTTTCCCACATTTGATGTGTGATGGACACT
GTTGAGGGGAGTTTATGCCTCTTTTAAGCCGAAGTGCACT
GATCAAAGCGCATACAGTAGTGGTTTAACAAATATTTCGC
CAAGAAAGCAGCACGTTCTTGTTCAGAGCAAGAAAACAGA
CTGAAAGGATGCTCACTGTTACGAGGAGTCGGTGCTGTTG
GATGTTGCCGCTGATCGTCGCGTTTGTGCGGATGGGAGAA
ACTCAGGGGATCGAGAGCCAGGCTCAGGTGAACTCCATCA
AATCTCTGGAGCCGCAGCCCGCCGCCGCTAACCGCTCCGG
GGCTTCATACAGCGGCATCCCGAAGAAGAGCAACATCCCC
GCTCAGGGTTATCCATGCAGCAGTGATAAAGAGTGTGTGG
TGGGAACGTACTGCCACAGCCCTCAACACGCGCCATCCCG
CTGCCTGTCATGCCGCCGGAGGAAGAAGCGCTGCCACAGA
GACAACATGTGTTGTCCGGGAAACCGCTGCAGCAACTACA
TCTGCATTCCGATCTCAGAGAGCGCCTTGTCCTCGCACAA
ATCCTCTATGGATGAGAACAACAAGTTTTCCATCAAAGAG
AAGAACTGGAAGAAGAACGGGAAAGCTCACGCCAAGATCT
CTCTCAAAGGTCACGAAGGCGACCCTTGCCTGCGATCGTC
CGACTGCTCGGAGGGCTACTGCTGCGCCCGCCACTTCTGG
ACCAAAATCTGCAAGCCCGTCCTGCGGCAGGGGGAAGTCT
GCACCAAACAGCGCAAAAAAGGCTCCCACGGCCTGGAGAT
CTTCCAGCGCTGCGACTGTGCCAAAGGACTAGCCTGCAAG
GTATGGAAAGACGCCACCTCATTCTCCAGATCCAGGCTGC
ACGTGTGCCAGAGGATCTAAGAAGGGACGTTCCATACAAA
ACAAGCAGCACCTTGAGGGCCCTGCGTCGGACTCCTTTTC
TGCAGGACTTACTTAGCTGTGATAAAGAGTGAGATACAGA
TGAATGTGTGCCAGAACAGGGTGGGTTTAGGACGGGAATG
AAGCGAAACAGCGGATACTCAGTGTGATGCACTCCGGGCA
TCTTTTCTGGAGGTTTCAATGATTTACAAGCCATATTTAT
CTCTGGTAGAGGGCTGGGATTGATGGTTTTAGTGTCTTCT
CGGATCTGAATGCTCTGATTTGTTTTTGTTTTGTCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dkk2-201 Contained in:
OTHER dkk2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000041347 (1)
  • Ensembl_Trans:ENSDART00000114098 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC153973 (1) 1373bp
    GenBank:CO796314 (1) 847bp
    CITATIONS (2)