Transcript

adgre10-201

ID
ZDB-TSCRIPT-090929-21251
Name
adgre10-201
Previous Names
  • adgre10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041178 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041178|OTTDARG00000029907|ZDB-GENE-090313-152 adgre10|OTTDARP00000032900 CH73-341P18.7-001 LG_ CU571167.5 Danio rerio protein_coding NOVEL, 3625 bp
AAGCAACAAACAGTAGGAGTATTCAGTCTAGTAGGAGAAG
ATCACTGAGTGTAAACGCAGATCAGATAAAGTGAAATACA
CTGGAACGTCAAAACTGACCATGGGCTTTTGTGGAGGCTT
TATAAAAGTTCAGACTGTCTTGTCTATTGTGCTGTGTATT
GCATTGGAGCAGCTTTTACCCAGTGCTAGTCTGACTGACC
CCTGCAACAACTACACTGTGCTGAACGATTCATGGAGACA
CATTGGTAATTCACAACCCCCCATCATGTGTGATGCCTCA
GTCTCCTGGAGCGGCTGGTATCGGCTCTTCATTAACGGTC
TGAGCGCTCATATCCCAGACACATGTGTTGAGGTCTATAG
CTGTGGCACTGCTGCCCCACTGTGGATTAGTGGTGGACAC
CCAGCAGTAGAGGATGGAGTCGTCACTCGAAATGTCTGCA
GTCACTGGTGCGGGGACTGCTGCCTTAACGGCTCTTTTTC
CATTCAAGTCAAAGCTTGTCCTGGAAATTATTCTGTCTAT
GAACTGATTAGTCCCTTAATTTGCTCAGCCTACTGTGCAG
ATGTACATACAACACTGGAGGAAGCATGCACAGATTGGAC
TGCTAAAGATTGTCTTGTAAACATTCTTGAGCTGATAGAG
AACATCACGGTTCAAGTGCTTCCTTTAAATACAGTGACCA
ACTATTTAGACATGGTCCTTGAAGCCACAGAGAAGTTTTT
AGTGTCTTCATCGTCAGACAGCCCGGCTGAACTGGCCTCA
TATGGAAACCGTGTGCTGGAATCCACTGAGAAACTCATCT
CTACACTGGTGAAGCTGACAGACACAAGTGCCAATGTCAG
TTTTACTCTGGAGAATGTAGAGGGACACGTTTTCATGGTT
GGACCAAATGTCACTTTAAATGAAATCCTTCAACTAAACA
CAACTAATTCATTTATGGACATTGATCTTATTGGCATTGC
CAAGAACAACAAGGACACACGATCTGCTGCTGTGGCTTTC
ATGAGCTACACTATAATGGAGAATCTACTGAAGGCCGACT
TCTTCAACACACAAAAAAACACAAATAAAACCATGATGTC
CACTGTGATCTCAGCTACTCTTCCCAAAACCAGCAACACT
GCACTCACCAAACCAGTCAACTTCACCTTCAGACACATCA
GAGAGTTTGACCCCAGCGGTTCTCTGTCCTGTGTGTACTG
GAATATCAGCGAGTGGATTGTAGATGGTTGTTCTGTGTTA
AACAGCAACAGCAGCCACACTGTGTGTTCCTGTGTTCATC
TGTCCACATTCGCTCTCATCATGCAGACCAGCAGCAGTCC
ACCACCGAGCGATCTGCTGGATCTGCTGAATCTGGTGTGT
GTGATCGTGGGTCTGGTGTTCTTCAGTTTGGCTCTGTTGT
CCTTTGCTCTTTGTCAGTGGAGTCCTGGAGTCAATAATGT
GGCTCGAATCAACATCTGCATCAGTCTGCTGTCGGCTCAC
CTTCTGTTGCTGCTCACACAACAGTTCCTGAGCCTCATTC
GCCCTCAGCAGGTGTTGTGTGTGGTGATAGCAGGCCTTCT
GCACTTCCTCTTCCTCTCCGCCTTTGTGTGGATGTTCATT
GAAGCTGTGCTGCTCTTCATCTGCGTCAAGAACCTATCAC
AGGTCAGCTCCAGAAAGAAGGAGGTGCTTAGCAATGGATT
TCTGTGTGTGATTGGATATGTGGTTGCTTTGATTGGGGTG
AGTGTGTCTATTGGGATGGTTCCAGAAGGATACGGCAGTG
AACAATGCTGGATTAAAATGGATAAAGGCTTCTTCTGGAG
TTTTTTGGGACCTGTTTGCGTCATACTTGGATTGAACGTG
ATTCTCTTCATCAGCATCAGCATCTATCTGAACTCGGCAC
TCAAAAAGCTGAACGCTGAAGTTTCACAGTTGAAACAAAC
CAAGGTTATGGTGTTTAAAACACTGGGTCAGTTTGTGATT
CTTGGTTGCCCTTGGATTCTGGGTTTCTTCGCTCATGTCA
ATATGGTGGTGGAGATCGTCTTCATCATCATAAACTCTCA
GCAGGGAACCTTCATCTTCCTGATCTACTGTGTGCTCAGT
ACTGAGATCAGGCAGCAGTACAAGAAGATCTTCACATGTC
TGTGCTGTGGATGCAAAACCAACAACGTAAACACGGCCCT
CAAAACACGCTGAGGATTACACTTCAGGTTTAGACAATCA
AGTGCCATTTTAACATTATTTACACATTAAACATGATGAA
TGTGACTTTCATTATTTAACATCTTGCACTGTGCTTATTT
TACAAATAACATTTATTTAAAATGCTTTATAAATGTAACT
TCAACTCATGTTTTCTTATAAACATTTTATTTAAAACCCT
TTACAAAAATACCCCAAACCTCAACATTCACACAATCCAA
GAAGGAAAGAAAAGCATCTGTGTAGTGATTAGTGAATCAA
CATGTTTCACAGTCACAATTCATATCATCACTTACATGTA
TGTAAACTAACATTTTCCATCTTCTTTGGTATTGTTTTAT
TGAAAAATAAAATCTACTCATAAATTTGTGGCTTAGCTGA
CTTTTTTTTTAACATGCCAACCACGTAACCTCTACATCAA
GTGTGTTTTTTATGTACTTGACGTAGGATTATTCAAGTAG
GAATCACCTCGGGCCACCATTACACTGGAAACGACTTAAC
AGTGGCATCTCTCACAGTCCCATTACACCATATTATAGGA
AAAAAGTACAGGGTGCTTTCACAGAAAGACTTCCCTGAGG
TGTCCAAAAGGTCCAAAGTGCTGAAGAGAAACCACATCAC
TGTTCTCTTGCACATCATAGCATCTCCATATCTAAAACAG
TGCACAAAAAAAAAACTGGAACAGCTGGAAACCTTCTGCT
GGACTAGACCCTAAAGAAATATTGCACCAAAATAAACATG
ACTTAGAAGCATAAACAAGTCTAGTCCAGCAACGTTTCAG
TCCATGTAGTCTCTTATCGGCTGAACATTACAGGAAAAAC
AGCTCTTTAAATAACGCAGCTCAAGAGAGCTCAGATATTT
AAACACTATGAAACAAAACATGGCAATGGTAGTGACTCCA
GCTTTATAGTACATGCAGCTCAAGAAGCTGGCAAAACATT
TGCAATAGTGTCCTTGGCATTCTGGGAGAGCTTTTCTGGA
AACCTGACCTCGTACTCAACAACCAAGTCTCCGCGGCGAT
CTGGAGCTTTGGGAAGAGGAAGACCTTCCCCGGTGAGGCG
CCGCTTCATCCCAGGCCGAACAATGTCCTGAGATGTTACT
TTAACCGTGCGACCATCTAGCGTTGGAACGTTAATCACAC
AACCACAAAGAGCCTGAGAAGAGTGGAGAAGAAAGACTTT
AGTAAAATGCAAGGTAAATGAATTATTTCTACGCGATTTT
CAGAATTCAAAAACATTACGGCTGAGCAACATCAAAATTG
GCAATTGTAAATTTAATATACAGATTGCAGTGATTTGAGA
TAAATTAGTGATTTAAAACAAACAAATCTTTGAGCGTCCG
CCACTAGCACACTGTCTGAAATAATTTTTAGCACTTCAGG
AAATGTATTTACTAGAGACGCATGGGCATGGGACGATAAC
GGTTTTGAGATGTACTGTGGTTTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations