Transcript

dnajb1b-201

ID
ZDB-TSCRIPT-090929-21222
Name
dnajb1b-201
Previous Names
  • dnajb1b-001
  • zgc:55492-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041144 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041144|OTTDARG00000029890|ZDB-GENE-030131-5455 dnajb1b|OTTDARP00000032873 dnajb1b-001 LG_ CU571167.5 Danio rerio protein_coding KNOWN, 1942 bp
AAACGCAGCTGTAGTTTCTTCTGGTTTCGGTTTTGCCCGT
TTGCTGCAGCAGCTGTGCGGGTGGAGCAGATCTGCCACGT
GGTCCAGGTCCAGGGGTGTGGAAACAACCAGAGACTTTGA
GAATTTTCTAGAACTTTCTTTACGGTTTTAAATAGGGGGA
ACCACAGAGCGGCAGGAGCATAAAAGACCGCAAGGGGACG
AGACGACACCTCTGCAAAGATTAGTTTCAGGTTGGTTTGA
AAACAAACAGGCTAGCAACACTAGTCTGAACCGCAGTTTT
TCTTTCGGAGAATATACATTTAAGAAACACGGAAGCCTAA
TGGTGAAGATGGGGAAAGATTATTACAGCGTTTTGGGGAT
TCAGAAAGGCGCTTCTGACGATGAAATTAAAAAAGCGTAT
CGCAAACAAGCGCTGAAATACCATCCGGACAAAAACAAGT
CAGCCGGAGCCGAGGAAAAGTTCAAGGAGATCGCGGAAGC
ATACGACGTGCTGAGTGACCCGAAAAAGAAAGACATCTAC
GACAGATTTGGCGAAGAAGGACTGAAGGGAGGTGCTCCTG
GAGGAGGTGGTGGTGGTGGAAATTACACATACACTTTCCA
AGGAGATCCTCATGCGATGTTCTCAGAGTTCTTCGGAGGG
CGAAATCCTTTCGAACATATTTTTGGACATAATGGCGGTA
TGGATGAGAACATGGAAACTGATGACCCGTTTGCTTCTTT
TGGTATGGGTGGCATTGGTGGTTTCCCTCGCTCCTTTACC
ACACATAGTCACGGTGGAAGAATGGAGAGAAAACAAGACC
CTGCAGTGATCCACGACCTCCGTGTCAGTCTAGATGAAGT
GTTCACTGGCTGCACCAAGAAGATGAAGATCTCACGCAAG
CGCCTGAACCCCGATGGACGAACAACACGCTCAGAGGACA
AGATTCTGACAGTGGAGGTGAAAAAAGGCTGGAAGGAAGG
AACCAAGATAACCTTCCCCAGGGAAGGCGACGAGACGCCG
TCAAATATCCCTGCAGATGTGGTGTTTGTGTTGAAGGATA
AACCGCATCCGGTGTACAAACGAGATGGATCGGACATCAT
TTATCCTGCAAAAATTACTCTCAAAGAGGCTCTTTGTGGT
TGTGTGATTAACGTTCCAACGCTAGATGGTCGCACGGTTA
AAGTAACATCTCAGGACATTGTTCGGCCTGGGATGAAGCG
GCGCCTCACCGGGGAAGGTCTTCCTCTTCCCAAAGCTCCA
GATCGCCGCGGAGACTTGGTTGTTGAGTACGAGGTCAGGT
TTCCAGAAAAGCTCTCCCAGAATGCCAAGGACACTATTGC
AAATGTTTTGCCAGCTTCTTGAGCTGCATGTACTATAAAG
CTGGAGTCACTACCATTGCCATGTTTTGTTTCATAGTGTT
TAAATATCTGAGCTCTCTTGAGCTGCGTTATTTAAAGAGC
TGTTTTTCCTGTAATGTTCAGCCGATAAGAGACTACATGG
ACTGAAACGTTGCTGGACTAGACTTGTTTATGCTTCTAAG
TCATGTTTATTTTGGTGCAATATTTCTTTAGGGTCTAGTC
CAGCAGAAGGTTTCCAGCTGTTCCAGTTTTTTTTTTGTGC
ACTGTTTTAGATATGGAGATGCTATGATGTGCAAGAGAAC
AGTGATGTGGTTTCTCTTCAGCACTTTGGACCTTTTGGAC
ACCTCAGGGAAGTCTTTCTGTGAAAGCACCCTGTACTTTT
TTCCTATAATATGGTGTAATGGGACTGTGAGAGATGCCAC
TGTTAAGTCGTTTCCAGTGTAATGGTGGCCCGAGGTGATT
CCTACTTGAATAATCCTACGTCAAGTACATAAAAAACACA
CTTGATGTAGAGGTTACGTGGTTGGCATGTTAAAAAAAAA
GTCAGCTAAGCCACAAATTTATGAGTAGATTTTATTTTTC
AATAAAACAATACCAAAGAAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations