header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-21172
Transcript Name: creb1a-201
Previous Names: creb1-001, creb1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000041090 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000041090|OTTDARG00000029852|ZDB-GENE-040426-750 creb1a|OTTDARP00000032823 creb1-001 LG_ CR762462.19 Danio rerio protein_coding KNOWN, 2023 bp
TCCGCCTACCTCTCGGATCTTGTCGATCCTGAATTAGGGC
TGTATTTCGTCCCCCTCGTTCTCTGTGTTGTTGTCCTCGG
TGACGCGACGGAGGTGTAGCCTGACGCGGTCTCTTACGTG
TCGGACTAAATAAAAGTGGAGCTCCGGAGGCCTGGGAGTG
ACGAGGCGAGTCTGTGTCGGGCTATCTAGATGACCATGGA
GGCAGGAGCAGATGTCCAGCAGGGCGGCGACACTGCGGTC
TCAGAGACAGACACTCAGCAGATTGCCACCTTGGCACAAG
TTTCCATGGCGGCAGCACAGGCATCAGCAACTGCACCCAC
AGTGACCTTAGTTCAGCTGCCCAATGGGCAAACAGTGCAA
GTTCACGGGGTCATCCAGGCAGCCCAGCCCTCTGTCATAC
AATCCCCACAGGTGCAAACTGTACAAATTTCTACTATTGC
TGAGAGTGATGATTCTCAGGAGTCAGTGGACAGTGTGACA
GATTCTCAGAAAAGGAGAGAGATTCTGTCTAGACGGCCCT
CATACAGAAAGATCCTGAATGATCTTTCATCTGATGCTCC
AGCGGTGCCACGGATAGAAGAAGAGAAATCAGAGGAGGAC
TCCACTCCAGCCATAACAACCGTTACTGTGCCAACGCCCA
TCTATCAGACAAGTAGCGGGCAATACATTGCTATCACTCA
GGGTGGGGCGATCCAATTAGCCAATAACGGGACGGATGGA
GTGCAGGGACTGCAGACACTAACCATGACAAACGCCGCTG
GAGCTCAGCCCGGCACCACCATCCTGCAGTATGCACAGAC
CAGTGACGGCCAGCAGATACTTGTTCCCAGCAATCAAGTG
GTGGTGCAAGCGGCATCAGGAGACGTTCAGGCTTATCAGA
TCCGCACTGCAGCTGCGAGCACCATTGCTCCTGGGGTGGT
CATGGCCTCTTCCCCAGCACTGCCCAGTCAGGGAGCTGAG
GAGGCCACACGTAAGCGGGAAGTTCGGCTGATGAAGAACA
GGGAGGCAGCACGGGAGTGCCGCAGAAAAAAGAAAGAGTA
TGTGAAATGTCTGGAAAACAGAGTGGCTGTGTTGGAGAAT
CAGAACAAAACGCTCATCGAGGAGCTCAAAGCGCTTAAGG
ACCTTTACTGTCACAAATCTGAATAAGTGCGCTCACGAAA
ACTTGCTGAACGGATCTCTTCTGGTGCCTCAAGAGACAGA
GACTCTAAACAAACCCACGGGCACCTGCACAGCAGCTCTG
TCTCTTCTCATTTCAATTTCTTTTCCTTTTTTTAAAAAAA
AACAAAACTATATATCATCTTCTGTAAAAAAAAAAAAAAA
AAAAAAGTCCAGTTATCAGGAATACATTGTAAGTTTGTTA
GTGTAAACTTTTTTTATTTTGCTTTTCTCTTCAGAAGAAA
GAGAGTCGGTTTCTCTGAGACAGAAAAAAAAAATTGACAC
GCAGGGTACAGTTTCGCTATCAAACACGGTGCCCTACTTA
AGGAGCGTGGAGAACCATAAAGAGCACCTTTTCACTGCAG
CAGTGACAGGGAACGAATGTTTGTGTGGGTTTATCATGGA
AACAGCCCCGGGTGCTGCTCCTGTCATCTGAAAGACTTTG
CCACACTGCGCCAGTCGCTGATGGCTCTGCCTGCCAGCAT
GATTAAAGAGGGATTGAGGTTTTCACTTTTGCAGCATGAG
TCTTTAACGATCCAGATTAAATCAGCTGTGTCCTTTCCTG
TTGTTTTACCGCTTCTGTTACTAATACATATACTCATAAT
TTTTGTTCTTCAAAAGACATGCAGAAGAATTTTATATATA
CGTGTCTCTGCTGTGACACGGACTGATGTGTAAAGCATCG
TTGTCTACCTTTTTATTTTGTTTTGTTAAGCAGTATTGCT
TTTGTTACAAAGTTAAGTGCTATAAGGAAAAACTCAGTCA
CATTTGTTAACGGAAATATAGGTGGATCCTTTAAGACGTG
GAATGATGATGTTTGGAAAAAAGTGTTGTAAAGTAAATGA
AATATATTATGTGATTTTCACAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
creb1a-201 Contained in:
[BAC] DKEYP-8H3 (1)

Genome Resources: Vega_Trans:OTTDART00000041090 (1),  Ensembl_Trans:ENSDART00000075632 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC044436 (1) 1968 bp
GenBank:BC164114 (1) 1024 bp
GenBank:EH590165 (1) 858 bp
GenBank:EH592804 (1) 795 bp
CITATIONS (2)