Transcript

creb1a-201

ID
ZDB-TSCRIPT-090929-21172
Name
creb1a-201
Previous Names
  • creb1-001
  • creb1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041090 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041090|OTTDARG00000029852|ZDB-GENE-040426-750 creb1a|OTTDARP00000032823 creb1-001 LG_ CR762462.19 Danio rerio protein_coding KNOWN, 2023 bp
TCCGCCTACCTCTCGGATCTTGTCGATCCTGAATTAGGGC
TGTATTTCGTCCCCCTCGTTCTCTGTGTTGTTGTCCTCGG
TGACGCGACGGAGGTGTAGCCTGACGCGGTCTCTTACGTG
TCGGACTAAATAAAAGTGGAGCTCCGGAGGCCTGGGAGTG
ACGAGGCGAGTCTGTGTCGGGCTATCTAGATGACCATGGA
GGCAGGAGCAGATGTCCAGCAGGGCGGCGACACTGCGGTC
TCAGAGACAGACACTCAGCAGATTGCCACCTTGGCACAAG
TTTCCATGGCGGCAGCACAGGCATCAGCAACTGCACCCAC
AGTGACCTTAGTTCAGCTGCCCAATGGGCAAACAGTGCAA
GTTCACGGGGTCATCCAGGCAGCCCAGCCCTCTGTCATAC
AATCCCCACAGGTGCAAACTGTACAAATTTCTACTATTGC
TGAGAGTGATGATTCTCAGGAGTCAGTGGACAGTGTGACA
GATTCTCAGAAAAGGAGAGAGATTCTGTCTAGACGGCCCT
CATACAGAAAGATCCTGAATGATCTTTCATCTGATGCTCC
AGCGGTGCCACGGATAGAAGAAGAGAAATCAGAGGAGGAC
TCCACTCCAGCCATAACAACCGTTACTGTGCCAACGCCCA
TCTATCAGACAAGTAGCGGGCAATACATTGCTATCACTCA
GGGTGGGGCGATCCAATTAGCCAATAACGGGACGGATGGA
GTGCAGGGACTGCAGACACTAACCATGACAAACGCCGCTG
GAGCTCAGCCCGGCACCACCATCCTGCAGTATGCACAGAC
CAGTGACGGCCAGCAGATACTTGTTCCCAGCAATCAAGTG
GTGGTGCAAGCGGCATCAGGAGACGTTCAGGCTTATCAGA
TCCGCACTGCAGCTGCGAGCACCATTGCTCCTGGGGTGGT
CATGGCCTCTTCCCCAGCACTGCCCAGTCAGGGAGCTGAG
GAGGCCACACGTAAGCGGGAAGTTCGGCTGATGAAGAACA
GGGAGGCAGCACGGGAGTGCCGCAGAAAAAAGAAAGAGTA
TGTGAAATGTCTGGAAAACAGAGTGGCTGTGTTGGAGAAT
CAGAACAAAACGCTCATCGAGGAGCTCAAAGCGCTTAAGG
ACCTTTACTGTCACAAATCTGAATAAGTGCGCTCACGAAA
ACTTGCTGAACGGATCTCTTCTGGTGCCTCAAGAGACAGA
GACTCTAAACAAACCCACGGGCACCTGCACAGCAGCTCTG
TCTCTTCTCATTTCAATTTCTTTTCCTTTTTTTAAAAAAA
AACAAAACTATATATCATCTTCTGTAAAAAAAAAAAAAAA
AAAAAAGTCCAGTTATCAGGAATACATTGTAAGTTTGTTA
GTGTAAACTTTTTTTATTTTGCTTTTCTCTTCAGAAGAAA
GAGAGTCGGTTTCTCTGAGACAGAAAAAAAAAATTGACAC
GCAGGGTACAGTTTCGCTATCAAACACGGTGCCCTACTTA
AGGAGCGTGGAGAACCATAAAGAGCACCTTTTCACTGCAG
CAGTGACAGGGAACGAATGTTTGTGTGGGTTTATCATGGA
AACAGCCCCGGGTGCTGCTCCTGTCATCTGAAAGACTTTG
CCACACTGCGCCAGTCGCTGATGGCTCTGCCTGCCAGCAT
GATTAAAGAGGGATTGAGGTTTTCACTTTTGCAGCATGAG
TCTTTAACGATCCAGATTAAATCAGCTGTGTCCTTTCCTG
TTGTTTTACCGCTTCTGTTACTAATACATATACTCATAAT
TTTTGTTCTTCAAAAGACATGCAGAAGAATTTTATATATA
CGTGTCTCTGCTGTGACACGGACTGATGTGTAAAGCATCG
TTGTCTACCTTTTTATTTTGTTTTGTTAAGCAGTATTGCT
TTTGTTACAAAGTTAAGTGCTATAAGGAAAAACTCAGTCA
CATTTGTTAACGGAAATATAGGTGGATCCTTTAAGACGTG
GAATGATGATGTTTGGAAAAAAGTGTTGTAAAGTAAATGA
AATATATTATGTGATTTTCACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations