Transcript

caspbl-202

ID
ZDB-TSCRIPT-090929-21041
Name
caspbl-202
Previous Names
  • caspbl-001
  • si:ch211-15j1.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040949 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040949|OTTDARG00000029771|ZDB-GENE-090311-53 caspbl|OTTDARP00000032724 CH211-15J1.6-001 LG_none BX469930.13,BX927298.8 Danio rerio protein_coding NOVEL, 1993 bp
GCAAGTTCAGAGCGTGTAGTTACAAGAATAAATTCTTCAA
GCAGAATAAGCGACTTTTCACCAACAGCCTGAGGTGGAAC
TGAAAGCAGCACTTATAGAGAAACCTGATCCAAGTCAGTT
AAGAAAAAGGACAAAGATCACTTGACAAAATCCCCTGTAG
TCCCTTTTTTTTCTCTTGTAACAGAAAATGGAGGATATTA
CCAAGTTGATAACTGATGTGCTCGAGGAACTTGTGGAGTC
AGAGCTCAAAGAGTTCAAAAGGCAGCTGTGGATGGGTGTG
AAAAAAGGCGTCGAAGCCATTCCTCGGGGAAAGCTGGAGA
ATAAGGACCGTCAGGATGTGGTGGACTATATGGTGCAGCA
TTACAGCATGGATGCTGGGAAAATCGCTGTACAGGCACTG
CGCAGCATCAAGCAGAACGAACGTGCAAATCGCCTCGAGT
CGAAACTTCTGGAAGTTCAGCCGCAGGCGCAAGAAAATGA
GCAAAACCCTGAAGACCCGCAGTCCATCAACACTTCCGGG
TCTGATGAGCTAGAGCCCATCCAGTCTGACTGGCAGAGAC
CACGAGGGATCATTAACCGCTTTCAAGAGTTTAAAACCAG
ACTTCTTTACGCAAACAGAGACGATGCAAGTATTTCAATA
CATTTTTACAAACAGAACACACTTTCAATTTACACACCAG
TGAGCAGGACTCAAAGAAAAGGCTTGGCTCTGTTAATCAC
CAACATATTATTCGCCAATAAACAAGACGACCGTGCCGGA
GCGGAGAGAGATGAGGAGAACATGGAGTGGCTCCTGAAAA
ACCTGAACTTTATGGTTATAAAATACAGAAATCTCACTGG
AAATGAAATCAGCAGAGCAGTGCAGGATTTCTCTCGACGT
CATGAACATCAAGACGCAGACAGCACATTTGTAGTCATCA
TGTCCCATGGGGATAGAATTCAAAATAAAGATGCCATTTT
AGGTGTCAATTACAACTGGCTTCAAAACCGTAATGACGTC
TACTTTGTTGAAGACACTTTCTCCCATCTGAACTCTGTGA
ACTGTCCTGCTCTGATCGACAAACCCAAGGTTATCCTCAT
TCAGGCCTGCAGAGGAGGGCAACTCGGTGGTGTGCCTGTT
AAAGATTGTGTGCCTGAATCTGACTCGTGGGTGCACAAGG
AGAAAGACTTTGTCTGCTTTATGTCCACCATGCCTGATGT
TGTTGCATACAGGGATGAGGTCAAGGGAAGTTACTTTATC
AGCTACATAGTGGATGTGTTCTGCTCATCAGCCTGCAAGG
ATCACATTATGGAGCTGTTTAGGAAGGTTGCCGCACGTAT
GGAGAAAGACGAACGTTTCCGACGTCAGGCGAAACTCTTA
CCATGCATTGAAAGGACGTCTCTTGTAAAGAAATTCTACC
TGTTCCCTGGACAGTGAAGATATGAAGAGTAAACTTAGAG
GTTTAGAGGGAAACAGCACAGGTGATCGGGGTAAAACATG
TACATCACCATGCTGAAGGACTTCTTTTCCTGCCAGAAAA
TTACCTCAATGCAAGTCATTATTAAAAACACAGGTATTAG
CAGTTTTTATATAAACAAATATTTGGAAAGGTCTTAGAAG
ATGGTACATTCCCTGCTTGATTATTCAACCTACAGTAAAC
ATTGTAATGAGGGGTGTTTTCTATTAATCTGTGGTGTTTT
TATTTCATATTATTTTCCTTGGTCGTTTATCATGTAATCA
CTTTATTACTACATGTAATGGTTTGCATTAATCAATTAAA
CCTTGAATGACTGCATTTCATCAATTCATTCAGTAATTTT
GTAGTAGGCTACTTGTTATCCTCCATTGTGTTATAATCTT
ATGTTTTCTGGAGATCAATCTGAAATATATAAAATAAGGA
GTGTATTTCAAGGTGTTTAATGGTACTTTACTCTGTTGTT
AAACAGTTTATTTTTATTGCTTGTGCTGTAATATCACTGG
ATGGATTTCTGTTTCTATGCTCAGTCAGTAAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations