header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-21041
Transcript Name: caspbl-202
Previous Names: caspbl-001, si:ch211-15j1.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040949 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040949|OTTDARG00000029771|ZDB-GENE-090311-53 caspbl|OTTDARP00000032724 CH211-15J1.6-001 LG_none BX469930.13,BX927298.8 Danio rerio protein_coding NOVEL, 1993 bp
GCAAGTTCAGAGCGTGTAGTTACAAGAATAAATTCTTCAA
GCAGAATAAGCGACTTTTCACCAACAGCCTGAGGTGGAAC
TGAAAGCAGCACTTATAGAGAAACCTGATCCAAGTCAGTT
AAGAAAAAGGACAAAGATCACTTGACAAAATCCCCTGTAG
TCCCTTTTTTTTCTCTTGTAACAGAAAATGGAGGATATTA
CCAAGTTGATAACTGATGTGCTCGAGGAACTTGTGGAGTC
AGAGCTCAAAGAGTTCAAAAGGCAGCTGTGGATGGGTGTG
AAAAAAGGCGTCGAAGCCATTCCTCGGGGAAAGCTGGAGA
ATAAGGACCGTCAGGATGTGGTGGACTATATGGTGCAGCA
TTACAGCATGGATGCTGGGAAAATCGCTGTACAGGCACTG
CGCAGCATCAAGCAGAACGAACGTGCAAATCGCCTCGAGT
CGAAACTTCTGGAAGTTCAGCCGCAGGCGCAAGAAAATGA
GCAAAACCCTGAAGACCCGCAGTCCATCAACACTTCCGGG
TCTGATGAGCTAGAGCCCATCCAGTCTGACTGGCAGAGAC
CACGAGGGATCATTAACCGCTTTCAAGAGTTTAAAACCAG
ACTTCTTTACGCAAACAGAGACGATGCAAGTATTTCAATA
CATTTTTACAAACAGAACACACTTTCAATTTACACACCAG
TGAGCAGGACTCAAAGAAAAGGCTTGGCTCTGTTAATCAC
CAACATATTATTCGCCAATAAACAAGACGACCGTGCCGGA
GCGGAGAGAGATGAGGAGAACATGGAGTGGCTCCTGAAAA
ACCTGAACTTTATGGTTATAAAATACAGAAATCTCACTGG
AAATGAAATCAGCAGAGCAGTGCAGGATTTCTCTCGACGT
CATGAACATCAAGACGCAGACAGCACATTTGTAGTCATCA
TGTCCCATGGGGATAGAATTCAAAATAAAGATGCCATTTT
AGGTGTCAATTACAACTGGCTTCAAAACCGTAATGACGTC
TACTTTGTTGAAGACACTTTCTCCCATCTGAACTCTGTGA
ACTGTCCTGCTCTGATCGACAAACCCAAGGTTATCCTCAT
TCAGGCCTGCAGAGGAGGGCAACTCGGTGGTGTGCCTGTT
AAAGATTGTGTGCCTGAATCTGACTCGTGGGTGCACAAGG
AGAAAGACTTTGTCTGCTTTATGTCCACCATGCCTGATGT
TGTTGCATACAGGGATGAGGTCAAGGGAAGTTACTTTATC
AGCTACATAGTGGATGTGTTCTGCTCATCAGCCTGCAAGG
ATCACATTATGGAGCTGTTTAGGAAGGTTGCCGCACGTAT
GGAGAAAGACGAACGTTTCCGACGTCAGGCGAAACTCTTA
CCATGCATTGAAAGGACGTCTCTTGTAAAGAAATTCTACC
TGTTCCCTGGACAGTGAAGATATGAAGAGTAAACTTAGAG
GTTTAGAGGGAAACAGCACAGGTGATCGGGGTAAAACATG
TACATCACCATGCTGAAGGACTTCTTTTCCTGCCAGAAAA
TTACCTCAATGCAAGTCATTATTAAAAACACAGGTATTAG
CAGTTTTTATATAAACAAATATTTGGAAAGGTCTTAGAAG
ATGGTACATTCCCTGCTTGATTATTCAACCTACAGTAAAC
ATTGTAATGAGGGGTGTTTTCTATTAATCTGTGGTGTTTT
TATTTCATATTATTTTCCTTGGTCGTTTATCATGTAATCA
CTTTATTACTACATGTAATGGTTTGCATTAATCAATTAAA
CCTTGAATGACTGCATTTCATCAATTCATTCAGTAATTTT
GTAGTAGGCTACTTGTTATCCTCCATTGTGTTATAATCTT
ATGTTTTCTGGAGATCAATCTGAAATATATAAAATAAGGA
GTGTATTTCAAGGTGTTTAATGGTACTTTACTCTGTTGTT
AAACAGTTTATTTTTATTGCTTGTGCTGTAATATCACTGG
ATGGATTTCTGTTTCTATGCTCAGTCAGTAAAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
caspbl-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000040949 (1),  Ensembl_Trans:ENSDART00000141787 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH589382 (1) 955 bp
GenBank:EH449549 (1) 921 bp
GenBank:EH475375 (1) 914 bp
GenBank:EE302524 (1) 835 bp
GenBank:CF996931 (1) 773 bp
CITATIONS (2)