Transcript

zfyve26-202

ID
ZDB-TSCRIPT-090929-20917
Name
zfyve26-202
Previous Names
  • zfyve26-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040813 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040813|OTTDARG00000029690|ZDB-GENE-030131-3286 zfyve26|OTTDARP00000032621 CH211-12D10.8-001 LG_none BX470227.9,BX323843.9 Danio rerio protein_coding NOVEL, 7798 bp
CGGCTCTCTCATGGCCACAGAGAGACAGCTGATGGGAAGC
GCTGTTCAAGGCGCTGCTCTCTAGTCTGACAAATAAAGCA
CAAACGCACATCATGTGAAGTACTTTATAACACACTGAGG
TCAGACATCTTTGAGGATCATGCACCCGTTCGGCCGTGAA
GAGGAGACCTCCAGGCGGGAGCTCTTCGGCTTCTTCCGCC
GGTGTCTGCAGCGCGGTGAGTGGGAGCTCGCGGCCGCTTG
CGTGTCTCAGCTCGGCGAGGCGCGTGCAGAAGATCCGCAC
AGTCCGCGAGACATCGTTAAGGCCATCGTTACACACCCGT
ACCCGCTTCGGTGGGAAACAGTGGGCAGCCCTCACAGACT
GGCCTGGTATTGGCTTCAGGTCCTGGAGAGACCGACTGAA
ATAAAGGTGAGCGTGTCTGTGAAGAGAGAACTGGAATTCT
TGTTGCTCTTAGAGGAGCTAGAAGACATCCCACAGTCTGT
GCTTAAGGAGCTGCATGAAGCCTTCCTATACTCAGAGGAA
GTGAAGGGAAAGGCTCCTGGTGATTCGGCTTCTCCACTGA
GTGCTGCTCTTCTGTCCTGCCTTCGCTCTCTTTTAACCCG
CCAGCAGCCGCGCCTCTGCCACTCTCTTATTAGCTTCCTT
TCTAATGGAGATCCGTCCAGAGATCACACCTTACAGGACG
CTTTCATCCAGCACCTCACAGAGCAAGTGAAAGTCCCGGC
GAAGGACAGGAATAGGGAATGGGTAGAGCAGGTGTGCTCA
GTGCTGGCTTTAGCACCGTGGGGGTCAGACAGGTCTGGTG
CTCAGCTGGAGCCCTTGTGGGAAGGTTTGTGGGCGGCTAG
AGAAGGGCTGATGACGGAGGAGCGGATTTTGGGATGTCTG
CTGAGGCCGCAGAGTCAGGCTCTGTTAATGGCATACAGCT
CCACAGCGCTCAGACTGCTCAAAGACAAGCTGCTGGCAGA
AGCTCCACACACACAGGTGGACTTGCCTGATCTAGAAAGG
GTCATGCTTGGTTTGTGCTGTCATAAAGACAAGCGCTTGG
CCTGGAAAGCCATTTACTTTGAGTGTTTGAGCAGCGGAAA
GCACTTTCTGGAGCAGGTTTTGCTTACTGGTTTAGATCTC
ATAAAGAGGGAGGAGTTCTCTAAACTGGAAACACTATTGC
ATTCTGAGTTCCAGCCTTTGTCCCGGCTCTTGCTTCTGCT
GGGCTGGATGCATTGTCAAAGCCTGGAGTCTGCCAAGACC
CTTCTTACAGTCTTACATCATCGTCAGCCCCAGAGCAATG
ATTCAGCATTGAGCGATTTGGCTTGCACTCTGTCCTGTCA
GCTTGGTGTGTTGGAATGGTGCACACAGAACAACCCAGGG
ATTTCCCATGATGCCTTGTTGAGTCACTTGCACATGCTGG
ACCATCACTCTGCCCTGTATGTGCTTCACTGCCTGACTCC
ACTCGCCAAGTTTGAGGAGCACAAAGTGTTAGAGCTGCTG
CAGAGAACAGGAGATCCTTCACAAGTGGACTCCCCTAGCA
GCTCAGTCCAGAGGAACATCACTCTCTTTCGAGGTTTTTG
TGCCATGAAGTATGCCCTGTATGCCATCAGTGTAAACGCA
CGCACTCATGCACACACTGGCTCTCTGGACTGTGAGCCTC
TGCATGAGCTGCAGACAGAGGCGGCTCAAGAGGACGAGAC
AGCTGAAGGATGCTCTAATCTGTTCCAGCACTACCTGTCA
GAATGTCAGCTGTACCTGGAAGCTGTTCCAGCATTATTCC
GTCTGGAGCTCCTAGAGAACATTTTCTCCCTCCTTTTCCT
TTCCGACTCTGACTTCACCCAACAAACCAGCACTGCCACA
GAAACCCAACCATACACTAACACTGAGACAAGTAAACCAA
AGAGCACTAAAGAAGTAAATACAGCTGAGCACTTCTTAAA
GGCAGAAAATGAAGGTGAAAGGATGGATGAACTGAACCAG
ATAAACCCTCAGCTGGGCCACCTGACATCTGGGTGCCGCG
GTTTTCTGGTGGACTTGAATGTGATGGAGGGGATCCTGCG
GCTGGTCAGAGAAGGTTTGGAGGGTGTGTGTGGAGTCGGG
CAGGAGGATGGAAGGGCTCTTGGGGCTGATGTGGAGCTGG
CAGAGAGTCTGGGATGTTCAGTTACTGCAGAGACATTCAG
CGCCCGCTTACAGAGACTGTCCAAATACACGGCAGAGGCT
CAGTGGAGACTGCAGATTGTTACCAGTAACCATGGCAATG
GGAATGATGGCTTGTACCTTCCATCTCCACTGCCCAGTCC
AGCGCTTCCTCTGAAACGGCAGGGCAGTGGCAGCAGTGGC
ACAAGCAGTCGGAGGAGGAGAAAACACCACCGGCATCGCT
CTGAACGGCACGTCTCATCTGAGCGACAGAACGGAGAAGT
CAGCACCAGCACCTCAGATGGTGGGGTGTGTGTCAGCGTT
GTGTGTCGTGGGACTGAAACGTGCCCGTGTGGTGGATCTC
ACAGCTGGCTGGTTCCTGCAATGCTGTCTCCTCCTGAGTC
TCTCCTCATCGCCTGTATTCGCAGAGGCAACTACATTGAG
GCACAGCAGGTGATTGCGATGTATGGTTTGGAGAACTCTG
AGTGTGCGGGGGAGCTGGTCTTTATGGACCGGTACAGGGA
GGTTCTGATTGAGCTGGCTCAGGTGGAGCAAAAGATCGAG
AGCCAGTCCCTTTCGACATCCTCTTCATCTTCAGAGGGTC
TGGGCACACTGGGTGCCACTCCAGCAGGCAGGACCAGAAT
GGGCAGCAGCAGCAGATTAACACTCAAGAGCATCGGAAGT
GCTGCAGCTGCAGGTATGGCTTTCTATTCAATTTCTGATG
TGGCTGATCGTTTAATGAGTACCCCGAGCAGGCCGATACC
TTGTCTAGAGGACAGTTACTGGCTCTCCCAGTGCACTATA
GACTCGCCTGACTTCGTGCGACCCCTTGTGGAAGAGTTGA
GCCCTGCAGCGATGGCAGCCTTTGACCTGTCCTGCTGTCA
GTGCCAGCTATGGAAAACATCCCGGCAGCTGCTGGAGACT
GCAGAGAGAAGACTCAGCAGCTTTCTAGAAGCCAGAGGTG
TACGAGTTGATCCAAAAGTTCCTCATGCCAACGGAATTAG
AGGATTCCCTTCAGTACTGCAACAAATCAGCAAGATCCTT
AATAAAACCTCCACCAACAAAGGCATGAGTAAAACAGACT
GTAATGGAGAGGAGAATGCTGTCTGTAGCCCTTTTGGCTG
CAGTGCACAGGAAGTGCTGCTGTCTTGTCATTCAACATTA
ACAGAGGAAAGCATCACCATCCAGCAAAACCTGAATCAGC
GCCTTGAGGTCACGCTTCAAACCCTGTCCTCTGCCACCAA
CACCTCAGTAGACAGTCTGGTGGGAAGCAATCTCCTGACG
GCACTGGCTGAACAGGCTGCTCTCAAGCAGTCTGAACTGG
ATTGTCACCCGGTGCGGACAGCAATGAAACAGCTCCTACA
GTATCTGGACCAGCTCTGCCCGCTTGTGCCTGATGGTGCT
CCTGACAGACCTGATTACATACGCAGCTTCTTCGATTACG
TCAATGTATTGGCTTCAGTACTGGTGCGCAGTTTGGGGTC
AGAGGATCAGTCCACTGTGGTGAAATTGGGAAATCCTCTT
TTACTGTTGCTCCAGTCGCCAGCCCAGCTTCTCTCTCACC
TACTGTTTGACAGACAGGTGTCACCTGATAGGGTTCTGTC
TCTTCTGCAGCAGGAGCGTCTTCGTTTGAGTGTGCAGCAG
GTCGTAGTTCAGCGCTGCTGTGAAACTCTCCCTCTCTGGG
ACTCCAGAGCTGTAAACTTTTCTCAGAGGGTCTCAGGACT
CAACGGTGGAGCTTTCTGTCCAGCCAGCATTGCCTCAATT
CTCCAGCAGTATGCTCAAGATTGTAGCCCTTCCCTTGACC
TCTCTGACCCCACCACGACCTCTGATCCCAGCTCTGAGTC
AGAGGTCTCAGTGGAGGACGTGTCTGCCGCGTCCACCAGC
CTCTCCACCTCTCCGCCCTCGCCATCTTCATCCTCCCCTT
CCTCTTCTTTTCTCCTCACTCCATCTGCGCTGTCTTTCCT
GAAGTCTCGTTCTCCTCTGGTTGCCGCTCTGGCTTGCCTC
AGTGCCAGTAGGGGTGGCGTGACCCGCGTGACCTCCTCCG
GTTGGTCAGGTTTGCCTTCATATTTTCGTGGATCTGGACG
TAAAGAGGCGGTTCTGGATGGAGAGCAGATCTCGAGGGAA
GGGGAAGCCCTGCTTAAGAACTTTCCAATTCTGAGAATGT
ACTTGCGGACTATGGCCGAACCAGTCCTGGGGGTCTCATT
GGAAGCAGATGAGGGTCTCGGGGTGGCCCTCTGTGGGAAG
CCTGTGGTGGGGATGCTGTTTTCAGGTCTGCAGGGCAATG
CGGCGCAGGCAATGGCTGCTGAGGCGTTTCAGCAAGCCCT
GAACAACGGCGATCTGAACAGAGCTTTAGATCTGCTAGAG
CTCTATGCACAACCGTGCAGCCAGGAGGGGGCACTGCGAG
ACAAACTGCTGGCTTTCACTGCACTGCAAGAATCCAGCAG
TGCTGAGCAGTTGTTTCGTGTACGGGACTGGGAGCTGCGT
GGACGTGTGGTTCTGCAGGGTTTGGACCGCTGGCCTTTAC
AACAGTGTTTAGATTTACTGCACTTCTGTCTCAGTGACCA
GAACACCAAAGATCCACTCCGAGAGCAGCTTCAGCAGAGG
AAACAGGAGCTGGACATGTATCAGCGGATGCTGAGATTGC
AGCCTTCATTGCCATGGGAGACGTGGCAGGAGTTGAGGGA
GGAGTCAACAAAAAATCCTGAATCTGTCTTCAGTCAAATG
CTGGAGGCCAGGGAATTTGAGTTGTGCGCCCAGTGGGTGC
AGCTTTATTCAGTTTCTGATCAGTCTGGAATGCAGCTGCA
GACCGAACACCTGCTGTACCTCCTAGAACACAATCACACA
GAAGAGGCTTTCCAGCTCCTGGAGGCTCTCTCTGACTCAA
TGGGTTTGGAGGTCAGCGAGCGAGCCCTGGATCGAAGACC
TGGATTGGCTGCCTGTCATTTCCTCTCAGATTATCTTACC
TTGCACTTCCAGAGTCAGATGACCCCAGCAAGGAGACGCC
ACATCCATGCCCTGCACCTTGGCTCTAAAGTTCTGCTGAC
TCTGCCAGAAGCGTCTCGCCAGGACTATTTTTCCCTGCTC
TCTGATCCGCTTCTCATGCTGGAGCAGATGCTGATGAATC
TAAAGGTTGACTGGGCGGCTGTTGCCATCACGACTCTGCG
GAGCCTTCTGCTGGCACAGGACGCTGGTATCACCACCCAG
CACATTGACACCCTACTGGCTGATTACGCCCGCAAGGCTC
TTGACTTTCCTTATGCTCCCAGAGAGTGGTCACGTTCTGA
CTCTGTCATTAGTCTGCAAGATGCATTTCTGCAGTGTCCA
GCTCAGGAGAGTTGCCCATCTTCTCCAAGCCACACACCTC
CTCCATCAACAGGAGGCACACCCATGCAAACACCCTCTAG
TGAGAGACGTCCCAGTGGGAAAAAGATCCGGCCACTGGCC
ACCCCTTTCACCCCTCCAGAGAAAACCCCTGACCGCAAAG
ACTGGATCCCAGACCACAAACAGCACATCTGCATGGTCTG
CCAGAGGGAGAGATTCACCATGTTTAACAGACGGCACCAC
TGCAGACGCTGTGGCAGACTGGTGTGCCATTCCTGCTCCA
GCAAGAAGATGGCAGTAGCCGGCTTTGACGAGCCGGTCAG
AGTTTGTGACCAATGCTACAACTTCTTTCACACAGACTCA
GATGAGGAGCTTGAACAAGGGGAAGTAGCAGGCAGCCCTT
CATCCATTGATGAGGTCTTGAATGGGGTGCTCAGTCTGCC
GGAGGTGTCACGGAAGCAGTACCGCCTGAGTCCAAACCCA
GCAGAGAACCAACAGCTGAAGAGCGAGTTCTACTACGAAC
AGGCACCCAGCGCATCTCTCTGTGTGGCTATTCTGACACT
ACACAGTGATCATGCGGCCTGTGGGCAGCAGCTAATTGAC
CACTGCCGCTCACTATCCCGAAAACTGACCAATCCTGAGG
TGGATGCACGTCTGCTGACTGATGTGATGCGGCAGCTACT
GTTCAGTGCCAAACTCATGTTTGTAAATGCAGGATGCACA
CAAGAACCAGCACTCTGTGACAGCTACATCAGTAAGGTGG
ATGTGTTAAAAATCCTGGTCACTGCCAACTACAAATACAT
TCCATCTCTGGATGATATTCAGGAAACGGCTGCAGTGACA
CGTCTGCGCAACCAGCTGCTGGAATTGGAATATTATCAGC
TGGCTGTGGAGGTGTCAACCAAGAGTGCACTGGACCCGAA
TGGTGTTTGGCAGGCATGGGCAATGGCATCTTTAAAGGCT
GGAAATCTGAGTGGTGCCAGGGAGAAGTTTGTTCGCTGTC
TGAAAGCACCAGTAGATCGAAACCAGCTAAACCACGGGCC
GAGACTTCTGCAAGAGATTATCCAGCACCTGGAGTCCACC
GTCAAACTCACCCTGAGCCAGACGATGGATGAGGATATCC
TGGCATCTCTGCGTGAGCTGGAAGAGGCTCTGTCTGATTC
TGCTCCTCCAGAAGGCACGGAAAGTAAAGTTCAGCGCTGC
AACTTTCATCAGGAGTGTCTGTTTTACCTGTTCACATACG
GCACACATCTGAGCCTCATCAGCTTTTACCTGCGCCACGA
CTGCCTGAAAGATGCCCTCACCTACTTACAGAACAAGGGC
TGTTCGGATGATGTGTTTCTGGAGGGCATCTTTCAGCCCT
GTCTTGAACGTGGACGTCTGGGTGCTTTACAAGGTCTGCT
GGAAAATCTAGACCCCACACTGGAGACCTGGGGCCGATAT
CTGCTTTCAGCCTGTCAGCTACTGCAGCGCAGGGGACACT
ACCACTCTCTGTACCAACTCCAGCAGTTCATGATGGACCA
CATTCGTGCTGCGATGACGTGCATCCGCTTCTTTTCTCAT
GGTGCTCAGTCATACCTGCAGCTGGGAGAACAGCAGCGCT
GGCTGATCCGGGCCAAAGAGCACCTGAGGACTTACCTACA
GGAGCAACAGAGCCGCAGGAAATCTCACAGCTCCTCCTTC
AGGAAGAAAATGAGCTCCACTGATGTCTCCAGACACATTC
ACACAATCGAGCTGCAGCTGGAGGTGACACGATTCTTACA
CCGCTGTGAAAGCTCTCCGTCTAAAACAGCAGTCGGCTCC
ACCTACACAGGAAACAGTGCTCCTCCCACTCTGTTTGGAA
ACAGCCCTATGAAGGTGGACGTGGCCTGTAAGGTGATGCT
GGGAGGCAAGAACATCGAGGAAGGTTTTGGCATTGCATAT
CGAGTAATACAGGATTTCCAGCTGGAGGCTCTGGCGGTCT
ACATCCGGGTGGGTCAGCGGCTGGTCCGGCAGCGGCAGTA
TTCCTCTGTGCGGCAGCTGCACAAATGTGTTGGAGAGTCT
GGGACGGCCTCCAAACACGACTGTGACGCCATTGTGCTCA
GCTGTGTGTCTGTGGCTGATAAGAGCCCTGCTGATGCTAA
AGAACTCGAGACTCTGATTCTAGAGTGTAAGAATCCAGAA
AACAAGATAAAGGCGTATCTGCAGTGCTCTAAGCTGAGGG
CTGCGTATCTTCAGGCGGTGAAACTAAAACTTGTAAAAGC
AACTCCACTGATACAAGAAGTGATGCGAGCAGCCGAGAGC
TCAGGTGACTCTGTCATGCATGACATCTGCCGCCAGTGGC
TCTCAGAGCATCAAGAGCCATCATCAAAACAAAGATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations