Transcript

dna2-202

ID
ZDB-TSCRIPT-090929-20858
Name
dna2-202
Previous Names
  • dna2-001
  • ottdart00000040753
  • si:ch211-1n9.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000040753 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040753|OTTDARG00000029657|ZDB-GENE-090313-71 dna2|OTTDARP00000032571 CH211-1N9.8-001 LG_ BX530068.35 Danio rerio protein_coding NOVEL, 4753 bp
GAAACAACGAAGAAGAAGTTGCTTATCATGTGATGTTTAT
TAATTCTACGCGGGAATCTGTTTCACTGCACAGATGAATC
AAAGGTTATTTACGCCAGCAATTGCTTTTAATTAATGTGA
AAGTAACAGTTACGTTCAGATGTCCGTCTGGCTGTAAGAA
TAACGTCATCAGTTTCTGGACGAAGTTCATCTTTTAGAGC
AGCTTTACAGTGGTGTGAGATGCTTGAAGTTTTTGAATGA
GTGTTATGCTTTTCTGCAAAGAACAAAACGCCTTCAGTCA
TTTTATTCACACATGTCTACAATGATGAAGTGCAAATCCA
GCCGATCATCTATGGTCAGTGGAGTTCAATCAAACATTTC
TTCATTTTTCCTCTCAAAGGTAGCGGTAAAGTCACCTAAA
AAATGTGAAGTAGGAATTACAAGATCCCCTGTTTCTTTAA
AGACTGGGTTTGTGAAGGACGAAAATGTTCCCTGCTCCCC
AAACCCATCTGCTGTCCCAGAGACGCCTGACAGTCTGAGA
ATCGAGAGGCCTTCAGACACTTCATTTGAGAAGCACTCAC
CTGTTTCACGTGGTCTACATACTAAAGGAGTCAGGGGTAA
ACCTAGCCTGAAGGCACGAAAGCTGTTGCAGCCACAGAAA
AGCAGCAGTTTAGAGTCAGAGGACACTTTTGAGTTCAAGA
ATGGCATAAGTCACTCAGGCTCCGTAAAGAGGTTGTTGCA
CAGCACTGAAAACATACAGAGTGCCAAGAAGTCCAGGACT
ACTCAAGATCAGAAAATAACTGATTGTGGCCCAAGCTCAG
CAACGGCCAGTCAAAATAAATATTCTGAAACATTGCAAAA
AGCTTTCTCTAAGAGTCCTGAGAAAAAAATCAAAACTGAG
TCTGTGAGTTTGGAGGGTAGCCGACTGAAGGCTGGACCTT
GTTTGAAAATGAATGAAAAATTAAATGGTTTCTCAAAAGA
CTCAGGAAGATCCTCTCATCATCTGAGCTTTAGTACTAGT
GAGAAGGAGAATTCACCTACTTGTAATGTGAAGTCAGAGG
CAGACATGGGTGCCGTTTCTGGAACAAATGACTTTGATCT
TGTGATGTCGTATAGTTCTTGGATACAAAATGGATCTACT
GAAGAAAAAGGTACTTTTCTTAACTGTCCAATTGCTAAGA
AGAGGCCCTTAAATACATCTGAGCTGCAAGTGAAAGAACA
AATTGCTGATGGAAAGACTTTGCCTGTACCATTTGAGGAC
GATTTTGCCGATTTGATGGACGATTGGTTTGATGAAGGGA
TGGAGCAAAAATCTGAGGCACCAAAACCCAAGAAGTTCAG
TCATGAAAAAAACAAAGGCATACCTGAGCATGTTGTGCTG
GCCTCTGGTGTTCATAACCGATATTGGGTGCTGGATGTGC
AGGACGTTACCTCGTCAAGAAGCTGCTCAGAGAAGCACTT
GACCATCACTTGCTCAAAGACGAGTCAGGCCACAGAGACC
TGCATTCTCAAAGATGGCTGGGAAAGTACTCTGGTAACTG
TAGGGGACATTATTCACTTGGAAGGGAAGTGTGTTTCCGG
CTTGTGGACAATTGATAGAGACTCTGCTTTCCTGATTCTT
CTGCCTGACCTGCTGATATCTGGGACCAGCATTGCCAGCA
GCATTCGCTGTATGAGGCGAGGGGTGCTGGGAGAGATGTT
CAAGGCATTTGATGGTGGATCCAAGCAGATGTTAAATGGT
ACAATAGTTCATGATATCTTTCAAAAAGCAGCCATGTCCT
CAGATTTCTCCTCAGAGAAGATACAGACATTTGCCACGGA
GGCCTTAAGAAGCCCCAACTACCTCGGACAAATGTACAGT
CTAAAGCTGACTCAGGCTGACATGAGACAGGAAGTTGAAG
AATATCTTCCCTCTATATCTGAATGGGCAAAACAATACCT
CCACACTTCCCCACAGGCAGGACAAAAACAGCTGACTCTA
AAACTCCCTAGTGATGGGGCTCTGAGCAAACAAGATGCTT
CCAGTAGCGTGATGGTTACTGATTTTGTGGACATTGAGGA
GAACATTTGGTGTCCACGTTTTGGTCTGAAGGGAAAGATT
GATGTCACAGCTGGAGTTAAGATTCACCGGAGAGGCAGGA
AGCCCATGGAAAGAATTGTGCCACTGGAGCTGAAAACTGG
CAAAGAGTCTAACTCCATTGAGCATCGCAGTCAGGTTATT
CTGTACACACTGATGAGCTCAGCTAGACGTTGTGATCCAG
AGGCAGGTTTCCTTGTCTACTTGAAGACTGGCAGTCTACA
TCCTGTTGTGGGCAATCACATGGACAGGAGAGAGCTGATT
AAAATAAGGAACTCATTGGCCCATCACATTGGCAACAACC
TGATCAAGGTGGATGGGAAAAGTCAAATGGCCCAATTGCC
TGCCATTGTATCTGACCAGCAAACTTGCAAATATTGTCCT
CAGAAAAGGAACTGTGCAATTTACAACAGAGCTGTGGAGA
GAGATCCTGTGGAGAAGTGCAGTGAAAATCCACAGGCCTT
TGTGCAGTCAGAGAGTGAACACCTCAGTCAGGTGCACCTC
CAGTACTTTAGCCACTGGCTGCTGCTCTGCTCACTGGAGG
CTCTCACCATGGAGAATAAAGGAGGTCGGCGTAATATCTG
GCTTCAGACTGCTCAACAGAGGGAGAAAATTGGTGGCTGT
GCGGGTAACATGCGGTTAGCTGGAGGCGTTAGCATTCTGT
CTGATGGTGTTTACAAGCACAGCTTTGAGAGGAAGGAGGG
CGAGCAGACTCTTACTGGCCTGATAGTGGGTGATAGGATT
GTTGTCAGTGATCAGGACTCTGTGCTCATTGGCCTGTCCA
CCGGATACGTCACAGAAATTGCAGTTAACCGAGTTACTTG
CTCGCTGGACAAAAACCTTTCCAAGTATTCCTCAAACACT
GTTTTCCGACTGGACCAGGATGAAGGTGCAGGTGGTCTTA
GCACTCATCTCGGAAACCTTTCTATGTTAATGGAAAACAC
TCCAACAAGTGAAAGACTGAGAGAGTTGATTGTGGAATTC
AGGCCTCCTCAGTTCATTGACAGCCTCAGCAGTGTTTTGC
CACGAGATGCCAAGGACATTGTGTCCAACATTCTGAAAGG
ACTCAACAAACCCCAGAAACAAGCAATGAAAAAAGTGCTT
CTGTCTAAAGATTACACGCTTATTGTGGGAATGCCGGGTA
CTGGGAAAACTACCACCATCTGTACACTGGTGCGAATTCT
CCATGCTTGTGGCTTCAGTGTTCTTCTGACTAGCTACACC
CACTCTGCTGTGGACAACATCCTGCTGAAACTGAAGAGGT
TTAAGATCGGCTTTCTGAGACTGGGTCGACCTCAAAAAGT
CCATCATGAGATCCTGCCTTTCACAGAGGAGGCATGCCGT
GCCAAAGGCATCCAAACTCTAGAGGAGCTGGAACAACTGT
ACAGCAGAGAGCTGATTGTGGCCACGACTTGTATGGGTGT
TAAACACCCAATTTTCAGCCGCAGGCGCTTTGACTTCTGC
ATCGTTGATGAGGCGTCTCAGATCAGTCAGCCTGTGTGTA
TAGGTCCACTGTTCTACGCCCAGCGCTTTGTCTTGGTGGG
AGACCATCAACAGCTTCCTCCTATTGTGCAGAATGCTGAG
GCCAGGTCCTTGGGCATGGATGAGAGTTTGTTCAAACGTC
TGGAACACCACAGGGATGCTGTTGTTCAGCTGAATGTGCA
GTACAGGATGAACAGTGCGATCATGTCTCTCAGCAATGCT
CTGATGTATGAGGGCCGGCTGGAGTGTGGCTCTGAGAAGA
CGGCAAACGCAGTGCTTCAGCTGCCCAGTAGAGCTCAGGC
AGAGGAGGAGCTGGAGCTGTACGTGTGTCAGCCGCAGTAC
AGTGCTTGGGTCCAGGCCGCACTGGAGCCCAACAGTCCTG
TCTGTTTCCTGGACACCTCTGAGGTTCCAGCCCCTGAAAC
TGTGGAGAAAAGTGGGATCAGTAATCACACTGAAGCTGTT
TTAGTACAAGGCCTTGTTACTCTGCTGCTTAAGGCTGGAT
GCAGAGCATGTGATATTGGGGTCATCGCTCCGTATCGACA
ACAGCTGAAAGTTATCTCCAGTCTGCTTCAGGGAGACGCC
TTTAAAGCACTTGAAGTCAACACTGTGGACAAATACCAAG
GACGTGACAAGAGCGTCATCATCGTGTCTTTTGTTAGAAG
TAATGCTGAAGGCAACCTGGGAGAGTTGCTCCAGGACTGG
CGTAGGCTGAATGTGGCCATCACTAGAGCCAAACACAAGC
TCCTCATGCTGGGCTCTGCCCCCACTCTTCGCCGGTACGC
ACCGCTGGAGAAACTTCTCTGCCACCTTCAGCAGGAAGAT
ATGATCTTCCAGCTACCTCCTGCTGCACACGAGGGACTAC
CTGGAGTCATCTTCTGATAAAAATAAAAACCTCTTGTAAA
CTGTGTGCTACATCACAAAGATAATGCTGTGAACAGTTAC
TTGAAAAAAACACTTAAGTAAAATAATACATACGATTCAG
ATAACTGTACTGTACTGTTAATATAGTTGCTCTCATGACT
GAATAGCGAAATTAATTTCTACCTCATGTCACATTTTTAA
AGTCATTATAGTTTTATCCATGTAGTGTCTAGACCATTTT
GAACATGTGCATTTTATATATACAGAAATGTATAAATGTA
AGTATTTATATTTGTTTTTCTTACATTTTTCAGAATTTTA
AGGTTTTGTTTAATAAAATATTTCACTCATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations