ZFIN ID: ZDB-TSCRIPT-090929-2071
Transcript Name: map2k2a-201
Previous Names: map2k2-001, map2k2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011786 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011786|OTTDARG00000010261|ZDB-GENE-041027-1 map2k2a|OTTDARP00000010179 map2k2a-001 LG_ BX088720.8 Danio rerio protein_coding KNOWN, 3193 bp
TGGCCGGACTTTTTCCCCCTCCTTTTTTCTTGGGGGAAAT
TTCAACTTCTGTTTTCGCGGCTCCTCCGAGCCAAACTATT
TCGGACAGCGTTTCTCGCCCGGTCCTGAGGCTGTGAACGA
TAGGCCTAACTTGTCTTTTGCCGCCTTTTGTCTGTGGGAG
CGCTCGCGAGTCAGAGGCCGTGCCGGAGAGACATTCCAGC
GATGCACGCGCTTAAATAAACTGCATTTCCTGCACTTTTA
CCTCTGAGCCACTCGCTTTTTCATTTGACACTTTAATTTC
ACCTGGAGCAGCTTTTGAGAGCATGATTGGGTGTTGAAAT
TTGGGGCTTGCTAATCTCAGAAACTTCCACTACAAGGGTT
TGTGTATCAGTTTGAAGTATTGGATGTCAGTAGAGACAAC
CTGGTTGCTTTCTTTGAAATTGATAACTTTGCAAGTATGG
CACCAAAAAGAAGACCAGTCCCCTTGATTATAACCCCCAC
TGGAGAGGGACAGTCAACCAACATTGATGCAGCAGCAGAG
GCCAACCTGGAGGCCTTGCAGAGGAAGTTAGGTGAGCTGG
ATTTGGATGAACAGCAGAGGAAGCGCCTCGAAGCTTTCCT
CACCCAGAAAGCCCAGGTGGGCGAGCTCAAGGATGAAGAT
TTCGAACCCATATGTGAACTTGGCGCTGGTAATGGTGGAG
TGGTTCATAAAGTCCGTCACAAACCCTCGAGACTGGTTAT
GGCCAGGAAGCTTATACACTTGGAAATCAAACCAGCCATC
AGGAACCAGATTATTCGAGAGCTGCAGGTTCTACACGAGT
GTAACTCACCGTACATTGTAGGGTTTTACGGCGCCTTCTA
CAGTGATGGAGAAATCAGCATCTGTATGGAGCACATGGAT
GGAGGCTCTTTGGATCAAGTGCTCAAAGAAGCCAGAAGAA
TCCCTGAGGAAATTTTGGGCAAAGTTAGCATAGCTGTACT
CAGAGGTTTGGCGTATCTTCGGGAGAAGCACCAAATAATG
CACAGAGACGTTAAGCCCTCCAACATCCTGGTGAACTCGC
GCGGTGAGATCAAACTGTGCGACTTTGGTGTGAGTGGCCA
GCTCATCGACTCTATGGCCAACTCCTTCGTTGGAACACGG
TCGTACATGTCGCCGGAGAGACTCCAGGGCACGCACTACT
CGGTTCAGTCGGATGTGTGGAGCATGGGCCTATCACTGGT
TGAGCTTGCTATTGGACGCTACCCCATCCCCCCTCCCGAT
GCTAAGGAACTGGAGGCCATATTTGGCCGGCCAGTGCTGG
ATGCAGGTGGGGCAGAAGGTCACAGCATGTCTCCAAGACC
CAGGCCTCCAGGACGACCAGTTAGTGGACACGGAATGGAC
AGCAGGCCAGCAATGGCTATATTTGAGCTACTGGACTACA
TTGTCAATGAGCCTCCACCCAAGCTCCCCCATGGCGTCTT
CACCACAGACTTTGAGGAGTTTGTGACAAAATGCCTCATA
AAGAACCCTGCTGACAGAGCTGACCTCAAGATGCTAATGG
GTCACACGTTCATCAAGCGGGCTGAGGTTGAGGAGGTGGA
TTTTGCTGGATGGTTGTGTAAAACCATGGGCCTTCACCAG
CCTAGCACACCCACTCATAGCGCTGAATGAATGCTGGCTC
ATACCGTTGCCACCCATGCCATCCTCCACTCTACTTCTGT
CCTCTTTGCTCTCACAGGCCTGTATGCTTGTAAGCCTCCG
ACACACCGCTGTGCACTCTTTTGCCGTTCTCTGCTTGCTC
TTCCCTTCCGCTGCAGTGCGTTCTGGGGGCATTGTTTTAT
AGGAGCCTCTGGTGTTGGAACACTTGGTCATTTGAACGAA
TATGGAGATTTATAGTCACTTAAGTGAAGTGGCTGTATTT
TTAACGACCAGCTTATTCAGGAATGTGTCCAAAATGGTTA
AGATCAACTGGGTTTTGGTTTTGTATAACAGCATTTTCAT
TAGCTTTATGATGCTTTTCTTTTCACCGTCTGTTTATTAA
TTAATCACAATCACAATCTCTGTTGCTAATGTGCCATTCG
TTGGCAATTAGCATTACACTGTGTTAAGATGTATAGCCTG
GTTCAATGGCAAGCATTTCATTATGAATCAACTGCCGTTT
AAAACAAGATAAAAGAATGAGAGAAAACCAAAGAGGGCTA
CTATGGATTATACACTATGGTTGGTTTATTACTAATTATA
AGGCGATTATTATAAATGCAGGATGGCCAAATCACCAATT
TATCAAGCACATGTGTACAAGTTTTTAACTTGTGCTTTGC
ATGGCCAGTCACACCAACAAATGGCCATGCCGTGAGTTTG
CACACATTACCACATATTAAAAAAAGCTATATTAAAGTTC
CTGTATCAGATGCCCTTAGTTCTGCTGTGCCTGTTAAAAA
GATCTCTTTTAGTATTCATATTTGGTTTGAACACCATTTG
ATCCCCTTAACATTGGCCCTTAAAAATGTTTCATCGCATC
TTTCTCAAGTATAGTTTAAATCATGCTTGACTCATTTTTG
CGACCAGTGCTTGAACGGTTTTCTTAGAACGTGCTTTATT
GAAATAATCTGTAGAAAAGTATATTTGGGTAAAATTATTG
TTTGTAATTTATGCTGTAATGTCTTTGATTTAAGTTTGAG
TACAACCAGAGTTGCACAGTGCTTTTTCCATGGACTCTAT
GAATTTGAACACATCCAAATGACTCCAACTAAGACCACAA
CAGGTACACTCATGGTTTGAACTTTAGTGGTATATAAAGT
GCAAAGTAATGTCTCAGGCCACCATGTACAGTGCTATGCA
GATCCAATGAACCTCAGCAGATATTACCGTATTAGTGGGT
CTTATAAATACACGGGTGTTACAGATGGGCATTGTGAAGT
GTGGCTAAAGCCCACTTGTTCTGAATAGCTTTGTGTTTCT
TTTTTTTCTTCTCTGTAGTACTTTTCAGTAACATTGAAAC
CGTATTACACACTGGCATTCAGCTCTGACCAAGTGAATGC
ATTGCCACACTTGCGTGTATAAAATAAAATATGTACAGTA
CAAACGGTACTGTTTTTCAGTCTTAAAAATAGCATTTTAT
TTTTGTTTTGTTTTTTTGACTACTTTCGAGAAGAGGATCT
AAGTCATTTTATTACCATATGGAATGTGTTGAATACAGTT
CTAATATAAAAATAAAACTTATTTGTGAATGAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
map2k2a-201 Contained in:
[BAC] CH211-195M2 (1)

Genome Resources: Vega_Trans:OTTDART00000011786 (1),  Ensembl_Trans:ENSDART00000010048 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK026627 (1) 808 nt
GenBank:CF995976 (1) 768 nt
GenBank:BM775700 (1) 671 nt
GenBank:BI845927 (1) 643 nt
GenBank:BI841928 (1) 639 nt
GenBank:BM890225 (1) 628 nt
GenBank:BI846000 (1) 621 nt
GenBank:BM104192 (1) 614 nt
GenBank:BQ258950 (1) 601 nt
GenBank:BI475720 (1) 587 nt
GenBank:BM081258 (1) 587 nt
GenBank:BI884130 (1) 572 nt
GenBank:BI707784 (1) 566 nt
GenBank:BG727743 (1) 560 nt
GenBank:AL922183 (1) 535 nt
GenBank:BI864428 (1) 511 nt
GenBank:BI429855 (1) 485 nt
GenBank:BI844043 (1) 483 nt
GenBank:BI841345 (1) 482 nt
GenBank:BG892549 (1) 474 nt
GenBank:AI396568 (1) 404 nt
GenBank:BI708022 (1) 390 nt
GenBank:BI846459 (1) 350 nt
GenBank:AA658708 (1) 302 nt
GenBank:BI429798 (1) 209 nt
GenBank:BG727491 (1) 208 nt
GenBank:AI384208 (1) 158 nt
CITATIONS (2)