ZFIN ID: ZDB-TSCRIPT-090929-2070
Transcript Name: onecut3a-201
Previous Names: onecut3-001, onecut3a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011785 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011785|OTTDARG00000010260|ZDB-GENE-050208-744 onecut3a|OTTDARP00000010178 onecut3-001 LG_ BX088720.8 Danio rerio protein_coding KNOWN, 1339 bp
TTTCAACAATGGAACTTACAATGGAAAACATTGGGAATTT
GCACGGCGTCTCACACTCCCATCAAACGGGAGACTTGATG
AACTCTCCTCACGCGCGACAGTCGGCGACACATAGGAACT
TGGTATCATCGCACGGGAGGTCAGCGATGGTGTCCAGCAT
GGCCTCGATACTGGACGGGGCCGGGGAGTATCGCACGGAC
CATTCGTTGTCCGGTCCTCTCCATCCAGCGATGACCATGT
CGTGCGATTCGAGCATGAGTCTGAGCAGCACTTACACCAC
CCTGACGCCGTTGCAGCACCATTTGCCTCCCATATCCAAC
GTCTCAGATAAATTTCACCATCATCCGCACCCTCACGCTC
ATCACCACCCCGCGCACCAGCGTCTCGCAGCCGGGAACGT
CAGCGGCAGCTTTACGCTGATGCGTGATGACCGGGGCCTC
GCGTCTATGAGCAACCTATACGGCCACTACTCCAAAGATT
TGTCCGGGATGGGACCACCTTTGTCACCTCTTTCCAACGG
CCTTGGGTCTTTGCACAACTCTCAACAAACTCTAAGTGCG
TACGGTCCGAGTGCTCACCTGGGGAATGACAAGATGATTT
CCTCGGGGGGCTTCGAGTCCCATGCTGCGATGCTCGGACG
GGGCGAGGAGCACCTGGCGCGGGGTTTAGGGGGACATGGA
GCGGGTATCATGTCTTCTCTCAACGGCATCAATCACCACC
ACCACCACAGTCACTCGCACTCTCAGGCGAATGGTTCGGT
GCTCTCGGAGCGGGACAGGCAGGCAGGAGCCGGCGGACAG
GGTGGTGGGTCGGGTCAAGTAGAGGAGATCAACACCAAAG
AGGTGGCTCAGCGAATAACGGCGGAGTTAAAGAGGTACAG
CATTCCACAGGCCATCTTTGCCCAAAGGATCTTGTGTCGC
TCTCAAGGAACTCTGTCGGATCTCCTGCGGAATCCAAAAC
CCTGGAGTAAACTCAAGTCAGGTCGGGAGACGTTCAGACG
GATGTGGAAGTGGCTACAAGAACCAGAGTTCCAGCGCATG
TCGGCCCTTAGGCTCGCAGCCTGCAAGCGAAAGGAACAGG
AGCAGCACAAGGAACGCAATATGGCGCCCAAGAAACAGCG
TTTGGTCTTCACCGACCTCCAGCGTCGCACACTCATCGCC
ATTTTCAAGGAGAACAAGCGGCCCTCGAAGGAAATGCAGC
TGACTATCTCACAGCAGCTCGGCCTGGAACTCAGCACCGT
CAGCAACTTCTTCATGAATGCACGTCGGCGATGTGTTGAC
CGCTGGCATGAGGAACACCATCACGGCCATGTAGCCAGTC
CTGGCCAGCCAGGCACCTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
onecut3a-201 Contained in:
[BAC] CH211-195M2 (1)

Genome Resources: Vega_Trans:OTTDART00000011785 (1),  Ensembl_Trans:ENSDART00000135984 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)