ZFIN ID: ZDB-TSCRIPT-090929-2067
Transcript Name: pias4a-201
Previous Names: pias4-001, pias4a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011782 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011782|OTTDARG00000010257|ZDB-GENE-040426-2734 pias4a|OTTDARP00000010175 pias4a-001 LG_ BX088720.8 Danio rerio protein_coding KNOWN, 4101 bp
GTGCGAAGATGGCGGCCGAACTGGTAGAAGCGATGAATAT
GGTGAAGAGTTTTCGGGTGTCTGATCTGCAGACTCTACTG
GCCTCGATGGGCCGCAGTAAAAGTGGTTTAAAGCAAGATT
TAGTGGGAAGAGCTCTTCGTCTTGTGCAGACCGAATACAG
TCCAGAGTTGCTAAAAAACGTCCGGCAGCTCTATGAGACG
CGCTTCCCCAAAGCCTCAGCCTGGCTGGCTGCCCGACGCC
CAGAGACCGTGGCTGTAAACTACCCTGCTCTCAACTCTTC
GCCCAGAGGCACGGGCCAGGGTACAGACTACCTCAACGGG
ATCCCCAAACCAGCCCCACCTCCTGCAGCCGAAGTCAAAC
TGGTGCCCCTGCCATTCTACCACAACCTAGAAACATTGCT
GCCACCCACAGAACTCGTTGCTCAGAATAGCGAGAAGCTG
CAAGAGAGTCAGTGTGTTTTTGATTTAACACCAAACCAAG
TGGATCAGATCCGGAACTCTAGTGAACTACGGCCAGGGAT
GAAATCAGTTCAGGTCGTTCTCAGAATTTGCTACACAGAC
TCTATCGGCGTTCAGGAGGACCAGTATCCTCCCAATATTG
CTGTGAAAGTGAATCAGTCCTACTGTCATGTACCGGGTTA
CTATCCCTCTAATAAACCGGGTGTGGAGCCGCGGCGGCCC
TGTCGACCTGTCAACATCACACCCTGGTTACACCTCTCCA
CAGTCACTAACAGAGTTACCATCACATGGGGAAACTTTGG
GAAGCGATACTCAGTGGCAGTGTACCTAGTGAGAGTGTTC
ACATCTGGAGAGCTCTTCAACCAGCTGAAGCATTGTTCAG
TGGAAAATCCTGATCGTTGTCGTGAAAGAATTCAGGACAA
GCTGCGCTTTGATCCTGAAAGTGAGATTGCCACTACAGGA
CTGCGAGTGTCCCTCATCTGCCCTCTGGTGAAAATGAGAC
TTGGGGTGCCGTGTCGAGTGCTCACCTGCGCCCACCTGCA
ATGTTTTGACGCAGTCTTCTTTCTTCAAATGAACGAGAAA
AAGCCCACGTGGACCTGCCCTGTATGTGACAAACCAGCTC
CTTTTGAGCTCCTTACTATCGACGGGTTACTGTCCGAGAT
TCTAAAAGAGACACCAGAGGATGTAGAGGAGATTGAATAT
TTGACTGACGGCTCATGGAGGCCAATCAGAGATGATAAAG
AAAAGGAAAGAGAGCGAGAAAACAGCCGCACGCCTGACTA
TCCAGTGGTGGATATATGTGTTCCTGAGGCGAACGGCCAC
TCCCCAGCACACAGCGGCACAAACCAGACCGGGAAGTCTG
GATCGGGAGGTGCGTCGGCAGGAACCGGCAGCACCAGTGG
GGGGTCAGGAGGCGGCACTGTGGTGGATTTGACTCTGGAC
GACTCGTCAGAGGAAGAAGGAGGCGGAGGAGCCGAGGACA
GCGAGGAAACAGACGACAGCCAGGACAGCCCCGCTCCTAA
ACGGGGCAGATACGACTATGACAAAGACCTGGTCACCGCA
TACTGAGACCGGCGGGACACATAGACTCATTGGGGAGGGA
GGGGGTTGTAGATGGTGGGATCTGAGCCTTGGAAATTCAA
GAAACATGTCCCCATGTCCTCTCCTGAATGCATACACACT
CATGCACGCACACAAACATGCACACTCATGCGCTGCAGAC
CTCTGGAGCAGGCGGGCATTGCAATGACGAACTCTCAGAT
GCCCCGTAAAGCCATTCCCAATCATTCACTGCATCTTAAT
TCTGTATCCTCCCTTTAAAGGCCATGGAAGAGTTAACACC
ACCTTCAGTTCTGCTCTGTCATCAAACATTTCCTCTCCAC
TTTTGAGTTTCGACAGGTTTAACCATACTGGGCGTTTAAG
ATCTTGCCAGTTTTCGTTTTAAATGAAGCTGTTCAGGCAT
TGAGACGAGCCACAGTATCTAAAAAAAAAAAAAAAACTTC
ATTCCTTCAGTTGTGATCATAGAATCTACTCAGAGGCGCT
TTCTGTTAGTCCTTCACATAAGATGTTTATATTAACTGTT
CGGTGTGATTGGAGATATCACTGAAGAATTTCCATCTCTC
TCACAATATTTTGTTTTTATTTGTCCACAAAAGTTGACAA
CCTACCTCAGTCTGACAGCGGACTTGACCAGAGGGTTATT
GAAAGGGCGTTGAATCCCTTACATGATGATTTTTGGTTGT
GTTTTGTTTTCGATCCCTTTGTTTTTCTTGTGCAGCAACA
CTGGAGAGGCATCAAGCATTGCTCATTGTTTTGTGCTTGC
CCATTTAGGCATCATATTAAAAAGCTATTGACTCGAGCAA
CGAGTTTCTGGTCAAGTCTGTCGGTCAACTTGCGTGTACT
GATTGGATGTAGTGCGCAAATCCAGAGGGAATGGAGTTTT
GACATCAACGGTCATTGTGAGATGCTAGTCAGCGGGTAAA
TATTGTATGATAGCTAAGCTAATAATTATAATGTATCGTT
TCTGATCATATATTAGGAAATCGCAGGTGTCAATTTAATT
TTGTTGCTTTTATTTTTTTGTCGTTTTGGTCTGCAAAGTC
AACGCAGACTAATAAATCAGGTTTAGGAGAGGACAAGGTG
ATGTTTTCTTCTTCTTCAAGACATGACTGTAGTAAATATT
AGACCTGATCTTATCTGAAATTTATTTTAAATTTCGACTT
GACAGTTTTCGCTTTTTATTTTAGACTAATGGCTGATTTG
TTTGAGCCCGTTTTTATTGAGGTTACCCGTTCATTTTCAG
CAGATGAAGAGGTGTTGAATTTTTTTTTTTCGCGAAATGT
TTTGTGGGCTTCGCACAGCCACAGTTCTTAAATATGTCAG
CATGTTGCTTTGGTAGAAAACGCTGTGTCCTCACACAGCC
TGCTGGTGGACGCACACATTCAGCCATTTGCGGCAGTTTG
AACGTAAGTGGGAGGCTTGGTCAGGACTATGCAGACTTGA
CCTAAACCTCGCAAGCATTAACTTGTGCTTAATGACCAAA
TACAAATGGCACATCCAGGAGGCTGATCTGCTGAGGATTC
AGGGATGACGCGTTAGTTCTACTTGTCTTCATATTTTCTT
CTCAGTCAACCCTGACAGGTTCTAGCATCGCGTACAATAT
TACCTTCACCATCAGGTCACGTAAAGCAGTCAAGGTCTCT
GATCTGGAAATTTAAATGTACTTTCATGGCATAGGAAGCT
CAATGATTTCTTCCCTTGTTCTTCAAAAAAATCTCTGCAC
TAAACCCACTGCAATTTTTTTAAAGTTTCTTCTTCAAACG
AATCCTGAATTCTGACTTGAATACTCTGTACTGTATCCTA
TCTGTGTTTGGAAAGTCTCATCAGAAGAATACCGTCATGA
AGGGTCAGTTTTAGGATTGTCTTTGGGTCGGCATGGTCTT
CCATCCTTTTTTTTCATGATACGCCCAACTTTTTTCACCT
TTTTGTTTTAAATGAATTATCTGCGCTGCTGTTAAGCAGC
TTCATATTATAAGCCCTTCATGTAGTACGTTCCTACAAAT
TTGACCAGTTTTGTGATTTTTCACATTTAAGGTAAGGAAC
TTAATAGACTTCCATCTTTAGATATTCTAGATCGTTCTAT
TAGAAAAATGTGGATAAAATGTACATTTGCTTACGATTAA
AAGGTAAATAAAAGGTGATCGACGACAATATATTTCCAGC
TCAGAGGAGAAAATGGCCTCTGTGTAGCCAGGTGAGGTTG
AAGTGGGTTTTTTTTTTGGGAATGGAGGCATCCCCTCTTG
TTACAGTGCTTAAGATAGCATGGGCAGTGGCTTGCAGTTC
TTGATGTAAATGTTTTGTTTGTGTCTTTTTATATGTTCAT
ATAAAAGCCAATAAAAATAATAATATTTTATCAAGTTTCC
AATTGCCTCCAGTTGCTCCAGCAGGTGGGCACAAATGCAT
TGTTATTGGCAACTCTCAAACTTCATGAGGATAATGTAAA
TTGGTGACCTTCAACGATGTCCTCAGCTTTAGATTTGATA
ATACAGGAGCGGATCAGTTGTTCCTCTCTGAAGTGAAATC
AAACTGTAAAAGCTCTAACACCTGTCAATTATTGTGTGCA
ATTAAACTGATTTAAAATAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pias4a-201 Contained in:
[BAC] CH211-195M2 (1)

Genome Resources: Vega_Trans:OTTDART00000011782 (1),  Ensembl_Trans:ENSDART00000105520 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC057528 (1) 3295 nt
GenBank:CD754320 (1) 931 nt
GenBank:BI704410 (1) 842 nt
GenBank:CD754748 (1) 836 nt
GenBank:CD758392 (1) 796 nt
GenBank:AW116843 (1) 788 nt
GenBank:CD281273 (1) 760 nt
GenBank:CK236968 (1) 719 nt
GenBank:BE556997 (1) 692 nt
GenBank:BE201494 (1) 662 nt
GenBank:BI888199 (1) 627 nt
GenBank:AW153425 (1) 611 nt
GenBank:BI888452 (1) 600 nt
GenBank:AL728046 (1) 586 nt
GenBank:BM184100 (1) 574 nt
GenBank:AL725687 (1) 546 nt
GenBank:AI793805 (1) 543 nt
GenBank:BI884873 (1) 541 nt
GenBank:AI877853 (1) 539 nt
GenBank:AL727981 (1) 522 nt
GenBank:BI706048 (1) 502 nt
GenBank:AW116660 (1) 484 nt
GenBank:BF158056 (1) 476 nt
GenBank:BU710020 (1) 463 nt
GenBank:AL725736 (1) 453 nt
GenBank:AW134345 (1) 389 nt
GenBank:CB366085 (1) 332 nt
GenBank:BI888109 (1) 322 nt
GenBank:AL714564 (1) 236 nt
CITATIONS (2)