ZFIN ID: ZDB-TSCRIPT-090929-20641
Transcript Name: cdh23-202
Previous Name: cdh23-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040496 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040496|OTTDARG00000029508|ZDB-GENE-040513-7 cdh23|OTTDARP00000032364 cdh23-001 LG_none CR762439.8,CT574545.5,BX510660.12,CU234114.17 Danio rerio protein_coding KNOWN, 1704 bp
TTGGTATAAAGTTGTACATTTCAGCCCTGTTTTCAACAAG
ACTCAAGAAGTACTTTTTTTATGGCGCACATTTGTAGTTC
GTTTTTACAAAAAAAAATCCACTTTTGTCAGTTAGAAGTC
CGAGGTATAGAAGGCTTGCTGAAATAGCACGAAGATAATG
ACACCCGACAATCCTGCTCAGTCATGCAGCATTCAACTTG
TTTTAAACTTGAAACCGCAACATGATGATGCGCGTGCGAG
AGAGAGAGGAAAGAGAGAGAGCATTGAGTGCGCGCACGCG
GAGAACCAGCACTCTCTCAGCAGCAGAACTAGCGCGCGCG
CTCGCTCGGTAGGTCGGTCGGTCGGTTGTCAAGAGCGCAC
GGACCGGACTGATCAGGAGGAGGCAGCAGGTTGGAGATGT
CGTGGTGTGAAGGTTCGGGAGGCAAGATGACGTGGGTGAA
GTTGCTTCTTTCCTTAGTGCTTCTACACGCAGTTTCTGAA
GCCTCCGCTAATCAGCCACCTCGTTTCCAGAATTACTTCT
TCCAGTCGTACCTGCTCGTCTATGAGGACACACCAGTGGG
TACCTCAATTACCCAGCTGCAGGCAGTGGATCCGGATGGC
GAGCCGCTGATTTTCGGTGTGGTCGGGGAAGAGGCCATGC
GCTACTTTGCTGTGCAGGGAACGACTGGAGTGGTGTGGCT
GAGGCAGCCGCTCGACAGAGAGGCCAAGTCAGAGATGCAG
GTGGAGTTCACTGTGAGCGACAGTCAAGGGGTTGTCAAGG
ATACAGTGAACATTCAGATCGGGGACGTAAATGACAATGC
TCCATCATTTTACAACCAACCCTATGCCATTCAGATACCA
GAGAACACTCCAGTTGGGACGTCAGTGTTCATGGTGAATG
CGACAGACCCAGATCAAGGAGTCGGAGGCAGCGTCTTGTT
CTCCTTCCAGCCTCCCTCTCAGTTCTTCTCTATTGACGGA
GCCAGAGGAATCGTCACTGTGACCAGAGCGCTGGACTATG
AGACAACTATTGCATATCAGCTCACCGTTAATGCCACGGA
CCAGGATAAACGGCGTCCTCTCTCTAGTCTGGCTAATTTG
GCGATTACCATCACTGATATTCAAGACATGGACCCCATCT
TCACCAACCTCCCCTACAGCACTAATATAATGGAGGATGC
ACCACCCGGTTATGAAGTCCGTAAGATCAGAGCGATTGAT
CAGGACTTGGGTCGACCACGTGGAATTGGATATACAATCA
TATCAGGTAACACCAACAGCATGTTTGCTCTTGATTACAT
CAGCGGATCCCTGACAGTGAGTGGACAGCTGGACCGGGAA
AACCCACTGTACTCATCTGGATTCATCATCACAGTGAAGG
CTACAGAGCTGAATGATGACCGCACACCCTCTTCTGCCAC
CGTCACCACCACCTTCACCATCCTGCTGATCGATAAAAAC
GACAATCCACCCAGATTCAATAGCTCAGAGTATCGTGTCC
TCATCACCGAGCTGGCACAGGTCGGCTTCGCTCTGCCTCT
GTACATACAGGTGGAAGACAAAGACGAGGGGGTGAACAGC
ATGTTTCAGGTGTTCCTGACGGGGAATAACTCGGATCACT
TCAGCATTTCTCCCACCTCAGTGCAGGGCAGAGCTGACCT
CCGCCTGCGTGTGGCCATCCCGCTGGACTACGAGACCATC
CGCAGCTACAGCTTCTCTGTGAGT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdh23-202 Contained in:
OTHER cdh23-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000040496 (1)
  • Ensembl_Trans:ENSDART00000135231 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY530192 (1) 11045bp
    CITATIONS (2)