ZFIN ID: ZDB-TSCRIPT-090929-20640
Transcript Name: cisd1-201
Previous Names: cisd1-001, si:dkey-18n13.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040495 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040495|OTTDARG00000029507|ZDB-GENE-040426-1162 cisd1|OTTDARP00000032363 DKEY-18N13.4-001 LG_ CT583720.8 Danio rerio protein_coding KNOWN, 2001 bp
TCCTGCGTAAATACAGCGCACAGTTGAACAGCGGGAATAC
TCCAGTTGGCCTTGAGGACGCTTCAAGATCCCAAAATTAT
GAGCAAATAATATTCATATTTATATAAAAAATAATAGTTC
ATCATGAGCGCGTCAAACTCCTTCCATAAAGCTGAGATCA
TCGCTGCGGTTTCTGTGACGTTCGGAGCTGCAGCAGTGGG
ACTCCTCGTCTACAAAACATTTTTCCACAATTCCAAATGT
GTAAAGCCAAAAGTCAACCTTGATCTGCAGAAAGACAACC
CCAAAGTGGTGCATGCGTTTGACATCGAGGACCTGGGTGA
CAAAGCGGTGTACTGTAGGTGCTGGAGATCCAAAAAGTTT
CCATTCTGCGATGGAGCTCATGCTAAACACAATCAAGAAA
CGGGAGACAATGTCGGTCCTCTGATCATCAAACGCAAAGA
GGCCTGAGCATTTCCACTGTTCTCAGTGATAGAGATTCAT
GTATTTTCGCTTTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGTTCTGGGGTGGTGGGATTAAAAGTGGTATT
ATATTACCTTGTGTGTGTGTGTGTTTGATACTATATGGTT
GAGAGTTTCCTGTGATCTGCTCTCAGACCTATAATACACT
GCAAATAAATGCTTTTCTTAGAGTTTTTGTCTTGTTTGTC
GTCAAAATATGTAAAAAAAAAATCTTAAACCATGAGGCTT
TGTCTAAACAAGTACAAAATAAGTGCATATTTTCTCAAAT
TAAGCTTAATTATCTGCCAAAGGGATCATAAAAAAACAGA
CTTCAAACCGATAGCAAGATTAATTTGCTTAAACCAGTGT
TTCTCAACCACACTTCTGGAGGACCACCAGCACTGGACGT
TTTCCTTGTCTCCTTAACCAAACACACCTGATTCAGATCA
ACCGCTCATTAGCAGAACCTAACAGACTTGAAATGGGTGT
TACAGACAAAGGAGACATCCAAAACATGCAGTGTTGGTGG
TCCTCCAGGAGCATGGTTGAGAAACACTGGCGGCTTACAC
CATTGGCAGATTATTTAGCTTGTTTTAAGGCAAAACTCAC
TTAATTATGACATATTATTTCTGAAAATAAAACATTATTA
TTTACTTGTCTGGATGCAAAAAATTCTTAGATGTTTGGAC
TAGAAACAAGACTCATATATAAGTAAAGCATTATTTGCAG
TGTGTATATTCTAATGCAGGAGTTCCCCAACTCAATCCTG
GAGGGCCGGTGTCCTGCATATTTGAGTTCCAACCCCAATT
AAACACACATGAACCAGCTAATCGAGCTCTTTCTAGAAAT
ACTAGAAACTTCCAGGCAGGTGTGTTAAAGGAAGTTGGAG
CTAAACTATGCAGGACATTAGCCCTCAAGGACAGTGTTTG
TACACCCCTGTTCTAATATATCTGGGTGGTGGTTTAGCAA
TACATATTTATTTTCTCTTCTTATCTGCTTAAAGGCTTTA
TAAGATGACTGATGTATTCTGGTTCAGCTAAACACTTCTA
AATGTGTTCCTGTGCTTAAACACTGGTCATGTTACTGTAG
TAGACATGATACATATTAAACTTGAACAAAGAAAAAACAC
CTTGGTATGAGTTGAAACCTAGTCTTGTTTGTTGTGACAG
AATGTAAATGTTGAATGGAAACCAAACGTCCAGCTTCTTG
TGTCCTTTCGAGTGTGTTGCCTAATAAATTCACATGTGAC
CTTAACTAATCACTGACATTTAGTGTATTGGAAATGAAAT
CGAATCTCTCTGAATGTGTTGAGTTGTGCTCTGGATCTGC
TGGGTCCTGTTTTATGTCAATTTAAAATATAATTTGGCAG
ACTTTGGCTCTCATGCGTAAAGATGTACTTGGTCTGTTTC
TATAGCAGAACAACAACAAAAGTATATGTTACATCGAGCA
TTGTGATGACCTGTTTTTTTCGCTGTCTCTTAGAAAAATT
CTATGTACAAGTTTGATGTTAAATAAACAATGTGAAACCG
A

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cisd1-201 Contained in:
[BAC] DKEY-18N13 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000040495 (1),  Ensembl_Trans:ENSDART00000110549 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC056783 (1) 1985 nt
GenBank:CK680520 (1) 512 nt
CITATIONS (3)