Transcript

lyst-202

ID
ZDB-TSCRIPT-090929-20539
Name
lyst-202
Previous Names
  • lyst-005
  • si:ch211-30i2.1-005
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040386 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040386|OTTDARG00000029434|ZDB-GENE-070702-1 lyst|OTTDARP00000032278 CH211-30I2.1-005 LG_none CU074338.9,AL928828.6 Danio rerio protein_coding NOVEL, 2266 bp
AGTCCTCATGGAGAGACGGAGCCGGCCTCTTTCTCCTGGA
CGTATGAGGAGATAAAGGAGGTTCACAAGCGCTGGTGGCA
GCTCAGAGACAACGCCATGGAGATCTTCCTGACCAATGGA
AGGACACTGCTGCTAGCCTTTGACAACACAAAGTTTCGTG
ATGACGTCTACCACAACATCCTGACCTCAGATCTGCCCAA
CCTGCTGGAGTATGGAAACATCAGCGCCCTCACGCACCTC
TGGAGCTCAGGACAGATCACCAACTTTGAGTACCTGACGC
ATCTCAACAAGCACGCGGGACGCTCCTTCAATGACCTCAT
GCAGTATCCCGTCTTCCCCTTCATCCTCAAAGATTACACC
AATGAGACGCTCGACCTGCAGGAGGCCTCTATTTACAGGA
ACCTCAGCAAGCCCATTGCAGTGCAGTCTAAAGAGAAGGA
AGACCGTTATGTGGACAATTACAGGTATCTGGAGGAGGAG
TATAAGAAGGGCAAGAGAGAGGACGACCCTATGCCCCCTG
TCCAGCCCTATCACTACGGCTCTCATTACTCCAACAGTGG
CACCGTCCTGCACTTCCTGGTCCGACTGCCTCCTTTTACC
AAAATGTTTCTGGCATATCAAGACCAAAGCTTTGATATTC
CTGACCGAACCTTCCACTCCATGAACACCACGTGGCGTCT
GTCGTCCTACGAGTCCATGACTGATGTCAAAGAGCTCATC
CCAGAGTTCTTCTACCTGCCCGAGTTCCTGGTCAACAGAG
AAGGTTTTGACTTTGGCGTGCGGCAGAACAGCGAGCGGGT
CAACCATGTGAATCTGCCGCCGTGGGCCAGAAATGACCCG
CGACTCTTCATCCTCATCCACAGACAGGCTCTGGAGTCCG
ATCAAGTCTCGCAGACGCTCTGCCAGTGGATCGACCTGGT
GTTTGGACTCAAGCAGAAAGGCAAAGCTGCGGTCCAGGCC
ATCAACGTCTTTCATCCTGCAACGTACTTTGGTATGGACG
TGTCTGCAGTTGAAGACCCTGTGCAGCGGCGGGCTCTAGA
AACCATGATCAAGACGTACGGACAAACACCCAGGCAGCTG
TTCAGCGCTTCTCACATCAGCAGAGCCGGAACCAAACTGC
TGTCAGAGGCTGAGCTGCCCGCCGCCATGGGTCTGCTGGT
GCAGCTGGCCTTCAGAGAGAGCCGAGAACAGCCCCGGGAC
AGCGGCTACCCGAGTCCTCTGCCGTGGATAAAGGGCTTGA
AATGGGGCGAGTATGTGGGTTCACCCAGTGCTCCGGACCC
TGTGGTCTGTTTCAGTCAACCTCACGGCGAACGCTTCGGC
TCCCTGCTGGCACTGCCCACACGTGCCATCTGCGGCCTCT
CACGCAAGTTCTGCCTCATGATGATCTACAGCAAAGAGCA
AGGTGTGAGGAGCATGCACAGCACTGACATACAGTGGTCT
GCTATTCTGAGCTGGGGTTACACCGACAACATGCTGCGTC
TGAAGAGCAAACAGAGCGAACCACCAATCAACTTCATCCA
GTGCTCACCGCTGCACCAGGTGAGCAGTTGTGCCTGGGTG
CCGGACAGTTGTCAGCTGTTTACAGGCAGCAAGTGTGGAG
TCATTACCGCCTACAGCAACCGCTTCACCACCACCATGCC
CACAGAGATGGAGGTGGAGTCGCAGGTTGATCTGTACGGA
CACACAGCCGAGGTCACGGGTCTGTTCGTCTGTAAACCCT
ACAGTATCCTCATCAGTGTGAGTCGGGACGGAACCTGCAT
ACTCTGGGATCTCAACAGGTTGTGTTACGTACAGAGTCTC
AGCGGTCACAAGAGTCCAGTGAACGCGGTGTCAGCCAGCG
AGACCACCGGAGACATCGCCACCGTCTGCGACTCAGTGGG
TGGAGGAAGTGACCTGCGGCTGTGGACCATTAATGGAGAT
CTGATTGGTCACGTTCACTGTCGTGAGATCATCTGTTCAG
TGGCTTTCTCCAATCAGCCGGAGGGAGTTTCAGTCAATGT
GATCGCAGGCGGACTGGAGAACGGGGTGGTCAGGTTGTGG
AGCACGTGGGACCTGAAGCCAGTCAGAGAGATCACGTTCC
CAAAGTCCAACAGACCTATCATAAGTCTGACGTTCTCATG
TGACGGTCATCATCTATACACGGCTAACAGTGAGGGCACG
GTGATCGCGTGGTGTCGGCGAGACCAGCAGCGCATGAAGC
TGCCCATGTTTTACTCTTTCCTCAGCAGTTACGCCGCAGG
CTGATTCACCGAAGGAGAGAAGGAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations