Transcript

fbxl20-002

ID
ZDB-TSCRIPT-090929-20367
Name
fbxl20-002
Previous Names
  • si:ch73-79d13.2-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040191 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040191|OTTDARG00000029314|ZDB-GENE-081031-27 fbxl20|no_translation CH73-79D13.2-002 LG_ CU658288.8 Danio rerio protein_coding NOVEL, 607 bp
GGAAGATGAAGCACTTAAGCATATCGGTGGGCATTGTCCA
GAGCTGGTCACACTCAACTTGCAGACGTGTTCACAGATCA
CAGATGAAGGCCTCATCACCATCTGCCGGGGGTGCCATAG
ACTGCAGTCTTTATGTGTGTCCGGCTGCGCAAATATTACA
GACGCCATCCTCAATGCCTTGGGACAAAACTGCCCTCGCC
TCAGGTACCCTAAACGTGCATGTGGGTGTAAAAATGCTCC
AAAATTGATCAAACAGGGGTCTTAAAAAAGTGTTAAAAAG
TCTTAAATTAAAAAATCGAAATGTATGGCTTTAAAAAGTG
TTAAATTTGCTGTTCTAGGTCTTAAATATTTTTGCACAGG
TCTTTTTTCTTTTTGCGATGTCCATGTATGCTCATTTAAT
TTCTTTTTGTTGTTGTTGCTAGGTTTTTGGGGTGTTGTAG
TTCTTTATTTCACTAGTCCAATTGTAATTTGCGGTATTAC
AACTACAAAAAGGTCAACTTGCAATAGCCAATCAGCTTTC
TGATATTAAACTCAGTGCGCGCGGCAAATGTGACATCATC
GCTGTGTTTGCGAAAGTTCGCTTTGAGTGCGCGCGACATG
ATTTCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations