Transcript

fbxl20-201

ID
ZDB-TSCRIPT-090929-20366
Name
fbxl20-201
Previous Names
  • fbxl20-001
  • si:ch73-79d13.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040190 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040190|OTTDARG00000029314|ZDB-GENE-081031-27 fbxl20|OTTDARP00000032125 CH73-79D13.2-001 LG_ CU658288.8 Danio rerio protein_coding NOVEL, 1869 bp
GGAGATAAGCTTGATTTGTTCATACTTCAACCACTGGGGC
TCTTCTGCATCTTTTCGCCGTACACAAACGCGATGAAATT
AAGCGAAAACACGGCATGAGCTCGACGGAAGCCAGCGGCA
CCGACACATCTGCGTCCTTTTAATAACCGGACGCGCTTTT
CCCTCTCCGGTTTACCGACTTTATAGTGTTCGGGATGGGT
AAGGAGGTGAACGGCGTCTCTCGGAGTCGCTTTGAGATGT
TCTCCAATAATGATGAGGCTGTTATTAACAAGAAGCTGCC
GAAGGAACTGCTGTTACGAATTTTCTCATTTCTGGATGTA
GTCACACTTTGCCGCTGTGCTCAAGTCTCACGATCGTGGA
ACGTGTTAGCTCTGGATGGCAGTAACTGGCAGCGCATTGA
CCTCTTTGACTTCCAGAGAGACATTGAGGGCCGTGTGGTG
GAGAACATCTCGAAACGCTGTGGAGGTTTCTTAAGGAAGT
TGAGTCTTAGAGGATGCCTTGGAGTTGGAGATAGTGCACT
CAGAACGTTTGCCCAGAACTGCAGAAATATTGAGCTGCTC
AGCCTCAATGGCTGCACCAAGATCACCGACAGTACCTGTA
ACAGCTTGAGTAAATTTTGTCCCAAACTGAAGCATTTGGA
TCTTGCCTCCTGCACCTCAATCACCAACCTGTCCCTCAAA
GCTCTGAGTGAGGGCTGTCCTTTGCTGGAGCAGTTAAACA
TCTCATGGTGTGATCAGGTGACCAAAGACGGCATTCAAGC
CCTCGTGAGGTGTTGTCCAGGACTCAAGGGCCTGTTCCTT
AAGGGCTGCACACAGTTGGAAGATGAAGCACTTAAGCATA
TCGGTGGGCATTGTCCAGAGCTGGTCACACTCAACTTGCA
GACGTGTTCACAGATCACAGATGAAGGCCTCATCACCATC
TGCCGGGGGTGCCATAGACTGCAGTCTTTATGTGTGTCCG
GCTGCGCAAATATTACAGACGCCATCCTCAATGCCTTGGG
ACAAAACTGCCCTCGCCTCAGAATATTAGAGGTGGCTCGC
TGCTCTCAGCTTACAGATGTAGGCTTCACCTCACTAGCAC
GGAATTGTCACGAACTCGAAAAGATGGATTTAGAAGAGTG
TGTACAGATTACAGATGCTACACTCATCCAGCTCTCTATA
CACTGCCCTCGACTACAAGTTCTGAGTCTGTCGCACTGTG
AGCTGATCACAGATGATGGGATCCGTCAGTTGGGCAGTGG
CCCCTGCGCTCACGACCGGCTGGAGGTCATCGAGCTGGAC
AACTGTCCGCTCATCACCGACGCTTCACTGGAGCATCTGA
AGAGCTGCCACAGTCTGGACCGCATCGAGCTGTATGACTG
CCAGCAGATCACCCGCGCCGGCATCAAACGCCTGAGGACT
CACCTGCCCAACATTAAAGTCCACGCCTACTTTGCACCAG
TGACTCCGCCTCCTTCAGTGGGCGGGAGCCGGCAGAGATT
CTGTCGCTGCTGTGTCCTTCTATGATGAAGACAAACAGAC
AAGAACCCCACATGCAGACATGAGCTTTAAGACACACTAC
AGTCCATTCGACGGCTTTATACCAGACCAACTGGGGGAAT
GTGCTACTCTGTTCATTGACAAACTCTTCAGAGGAGAGGC
CTTTATGACGAACACTTGGCCGCTGCTCAGAAACACCTCA
TCCTCATTGTTTTATTGGAAAGGACCACTTGATTGGAGAT
TACAAACGCGAGACCATCAGACGGTAAACCAGCTCACCTT
TATCACCACTAAACACACATTTACCGGTGTGTTTCTTTTT
CACCTGTGAACCCCTAAGGATTTGCTTCTGACGCAATTAC
ACACACACAAATACACACTCACTCTTTCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations