Transcript

nphs2-002

ID
ZDB-TSCRIPT-090929-2034
Name
nphs2-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000011637 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000011637|OTTDARG00000010134|ZDB-GENE-051102-2 nphs2|no_translation DKEY-171O17.6-002 LG_ CR381682.7 Danio rerio protein_coding NOVEL, 535 bp
GGAGTTATTAGCATTATTGGAGACTGAGGGACCTGGAGAA
GGCCTAAAGAAGAAATACCTTGGAGTTTGTGAGCTGCTTC
TCATCGTTTTGGTCCTGTCAGTGGTCATCCTTTTCTTACC
GATTTCAGTATGGTTCTGTGTGAAGGTATGATTTTGCTTT
GGGATTAAATATTAGACATGATTCTAGATTTATTTTCACA
TCTCTCAAGCTCCCAAATATTATTTTGTAGATTGTGAGAG
AACACGAGAGAGCTGTCAAATTTCGCTTGGGACATCTTTT
GAAGAAGAGACCCAGGGGCCCTGGTACACGTTTTAAATCG
CAAAATAACATATTAACATTACATATAACTGTGGTTTATG
CTAGTTATGGGATCAGTCTCCTGGACTTTTATGCTGTAAA
TAATGTTATGTTCCACACAATTCCTTCATGTTGTCCCAAA
ACAAAATGATTAAGTTAACTTAATATTTTTCACATAAAAA
AGTGGATGGAACATAAAACATATCAGTTGTTCCCATAAAA
AAACTAAGGAATTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations