Transcript

nphs2-202

ID
ZDB-TSCRIPT-090929-2033
Name
nphs2-202
Previous Names
  • nphs2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000011636 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000011636|OTTDARG00000010134|ZDB-GENE-051102-2 nphs2|OTTDARP00000010032 DKEY-171O17.6-001 LG_ CR381682.7 Danio rerio protein_coding NOVEL, 1491 bp
AAACACCAGAGGACACTTCACAACAGATCTCTGATCACGA
TGCTTCCTGCGGAGATAGAGAAAAGGACCGAAACAGAAAC
ATCTCGACATTCTTCAAGATCTGCCCGGATAAAGAGAGAG
CCATCGCCTTCTGCAAAAGAGAGAAAAACCAAAGCAGCCA
AATCTGTGAAGCTCCAAGAGCCCCACAAAAGAAAAGAGAA
ACTAGTAACGACAGAAGAAGAAGAAGAAGCAAAAGATGCT
CAGATCATCTCTAGCAGCACGGTTGTAAATGTAGACAGTG
TGAGGGAACGGATAAAAGAAGAACGAGAGGAGTTATTAGC
ATTATTGGAGACTGAGGGACCTGGAGAAGGCCTAAAGAAG
AAATACCTTGGAGTTTGTGAGCTGCTTCTCATCGTTTTGG
TCCTGTCAGTGGTCATCCTTTTCTTACCGATTTCAGTATG
GTTCTGTGTGAAGATTGTGAGAGAACACGAGAGAGCTGTC
AAATTTCGCTTGGGACATCTTTTGAAGAAGAGACCCAGGG
GCCCTGGGCTGATGTTTTATCTCCCATTTTTGGATGTGTG
TCATATAGTGGACATTCGCTTGCAAATACTGAAGATTCCT
CCTCATATGGTGGTGACCAAAGATCTGGTGTGTACAGAAG
TGACTGCGGTGTGTTATTATCGCATTGAGAACGTCTCTGT
GTGTTATTCCTCCTTCGCTAGCATTCCAGACGTGATGCAG
GCTCTGACACAAGTATCTGTTCGAGAGATACTGGCCCATC
ATGCCTTCAATGACATTTTGCTGGACAGGAAACGCATTGC
TCAGGAGATTCAGGTCACTTTAGATTCCGGAACCTGCAGG
TGGGGTATTAAAGTGGAAAAAGCAGAAATAGAAGAGATCA
ATCTTCCTCCAGAGCTGCAACATAACTTCGCTGTAGAAGC
TGAAGCAAGACGTCAGGCACAAGTTAAAGTAAGGGTGATC
GCTGCAGAGGGAGAAAAGGCTGCATGTGAGGCTCTGAAGG
CATCTGTAGAGTCTGTCTCTGGCTCTCCTCTGGTCATGCA
TCTTCGACTCCTCCAGCTCCTACACAGTCTACGCTCTGAG
CAGCCCGCCGTGGTCCTCAACATACCACCTGATGTCCTGA
CCCAATCCATCGACCTCGCCAGTTTGACCAGACCTGCTAA
TCAAAGCATGACCACATGTCACGGCTCAGATGATGGAACC
AAAGACTCACCCATGATGTAAAGACAATGTTACTGTTCAT
TTATATGACTTAAGTTATTTTTGGAATTCACTGTATTTCA
AGACTGTACTGATTATTGGCTGATATTCTACATTGTTTAA
ATTTATTGGTATTGGTTGACGGATTTCCTTCGCATCATCT
AACAATGAAATATAATTTCAAGTTTAATAGTAAAGTTTTC
AAAAAATATCCTCTATTTGTAACCTCTAAAGAACAATCTC
CTAAATCAAATAAAAAATGTGCATTATAAATAAAGATACT
GTATCTCAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations