header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-20319
Transcript Name: twist1a-201
Previous Name: twist1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040141 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040141|OTTDARG00000029279|ZDB-GENE-000210-6 twist1a|OTTDARP00000032090 twist1a-001 LG_ CU627989.4 Danio rerio protein_coding KNOWN, 1148 bp
GAGAAAGCCCTCCGTGACGCAGGAGGAGACGCGCTGAGAG
GGACCGAGCCTCTGACCCCATTCCGTCGGACTCAGGGAAG
CCACGACCCGCAATCTGAGCTTTTCCAGAGGTGATGTTTG
AGGAAGAGGCGATGCACGAGGACTCCAGCTCTCCAGAGTC
TCCGGTGGACAGTCTGGGAAACAGCGAGGAGGAGCTCGAC
AGGCGACAACCGAAGCGCGTCAGCAGGAAAAAACGCGCCA
GCCGCAAAAACGCCGAGGATTCCGACAGTCCCACGCCCGG
GAAGAGGAGCAAGAAGTGCAGCAACAGCAGCAGCAGCCCG
CAGTCTCTGGAGGACCTGCAGACGCAGCGCGTCATGGCGA
ACGTGCGCGAGCGTCAGAGGACTCAGTCTCTGAACGAGGC
GTTCGCCTCCCTGCGCAAAATCATCCCCACCTTACCCTCG
GACAAACTCAGCAAAATACAGACGCTCAAACTCGCGGCCC
GGTACATTGACTTCCTCTGTCAGGTCCTGCAGAGCGATGA
GCTGGACTCCAAGATGTCCAGCTGCAGTTATGTGGCGCAC
GAGAGACTCAGCTACGCGTTTTCTGTGTGGAGAATGGAGG
GCGCGTGGTCCATGTCAACATCCCACTAACGCACGGATGC
ACGCGTTTGATGCAGCATGATTCTCGGCCTGAGGAGCTGA
ACTCACTGGAAGGAGCGGCTCAAAACAAGGGCGAAAATAA
GGATTATAAAGGGAAAATTCTGGAGCGTCATGACGTCGTT
GCAAGCACTTACAGTTGTGAACTACGACATGGGAGCAGGA
ATTACAGTCAGATCTGTGCTGTTGTGACGGTGAATGTGGA
AAACATGTGCTTCCGTCCACAAAACAGAGACTCGCTGCAG
GAAAAGACGCTCCTGCGCTTCTGACAGCAACAACCAGCAT
GGCGTCATATTTTTTTCTCTGAAGGAAAACACACACACTC
AACGAATGAAGGAAATCGGCTCATATCAGTGTTAACATTT
TCTTTGATCGGTCTAAGAAAATACTTTTATTTATTTATTG
ATGATTGTCACAATGCAGAATAGATCTGGTGTCTACATGC
ATTTTCTATTTTAAATATGATGTAAATATCTGTATATTTT
CTGCAATAAAAACATGATTTGAAATGCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
twist1a-201 Contained in:
[Fosmid] CH1073-189B15 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000040141 (1),  Ensembl_Trans:ENSDART00000043595 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC076428 (1) 1175 bp
GenBank:DQ351987 (1) 1151 bp
GenBank:EH593542 (1) 968 bp
GenBank:EH579627 (1) 913 bp
CITATIONS (2)