ZFIN ID: ZDB-TSCRIPT-090929-20063
Transcript Name: acsm3-201
Previous Names: acsm3-001, zgc:172040-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039816 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039816|OTTDARG00000029057|ZDB-GENE-080220-22 acsm3|OTTDARP00000031832 CH73-60L17.3-001 LG_ CU467875.8 Danio rerio protein_coding KNOWN, 3790 bp
GTTCTGCAATGTCTCAACTTTGATGGACTTTTATTTTCAG
AACTTGATTTAATAGAAAGGGAAACGATTATTTAATGCAA
CCATTCTGAGATGCCGATCCGTGTGAAAGTTTCAGCTGTG
TGATTAATGTCGGGCTGGAGAAACAACTACTTGAGAGCTT
TAGCTTTACAGCGATAAAGATTAATAATGAACTTGTACGT
GTTTAGCAATCATGTTTTTAAACGCTGTCTGAAAAACAGC
CAGAGAAATGAAGTATACGCGCGAGGTCAGTGGCTGCAAA
CGTGCAGATTTAAAACATCTGCACCGAAAAACTTCAGCGA
TTACGAGAGCATGAGGAGCACTTACAAGATACAAGTTCCA
CAGCGGTTTAACTTCGCCAAAGATGTGCTCGAGAAGTGGG
AAACCAAAGAAAAGAGTGGACAGAGATCGTCTCTTCCTGC
TCTGTGGTGGGTAAATGATCACGGGACAGAGGTCAGGTGG
AGTTTTGAGGAGTTGGGCTTCCACTCTAGAAAACTTGCAA
ACGTCCTGCGTCAGGTGTGCAGTTTGGAAAGAGGGGATCG
TGTGTTCCTCATCTTACCCAGAGTCCCTGAGTGGTGGCTG
GTTAATGTGGCATGTATAAGAACAGGTACAGTTCTCATTC
CTGGCACCTCTCAGCTCACAGCTCGAGATATGCGTCACAG
ACTGATAACGTCTGGGGCCAAGTGTGTGATCACAGATGAA
ACTCTGGCTCCACTGTTGGACACTGTAGCCTTAGACTGCC
CTTCCATTTCCACCAAGCTGCTGCTGTCCCACAAGCCCAT
GGACGGCTGGGGCAACCTGACAGAGCTCATGGGAAGAGTA
TCAGATGACCATGTTTGTGTGGACACCAGCAGTGAGGAGC
CCATGACCATCTTCTTCACCAGTGGCACAACGGGCTCCCC
AAAAATGACCCAACACAGCCACTGTAGTTACGGTTTGGGG
CTCACCGTGAACGGCAGGTACTGGCTGGATCTGACTGAGC
AGGATGTATTCTGGAACACCTCTGACACGGGCTGGGCGAA
ATCAGCGTGGAGCAGTGTGTTTGCTCCGTGGATTCAGGGA
GCTTGTGTGTTTGTTCACCACATGCCACGCTTTGACACAA
ACACAGTTCTTAAGACTCTGAGCCACTATCCCATCACCAC
CTTCTGCACAGCACCGACCGCCTATCGAATGCTTGTACAG
GATGACTTGTCTAAGTATAAATTCCAGGCTCTTGAACACT
GTCTGTGTGCCGGAGAGCCCATTAACCCTGAGGTCATGTG
CAAATGGAAAGAGCTCACTGGACTGGACATCTACGAGGGA
TACGGACAGACTGAGACTGTTTTAATAGCGGGCACATTCA
AAGGCATGAAGATCAAACCAGGATCTTTTGGAAAAGCATC
ACCAGGATATGACGTGCAGGTGGTGGATGAAAATGGCTCT
GTTGTGCCAAAAGGACAAGAGGGAGACCTCGGCATCCGAG
TGAAACCAGAGAGACCCTTCTCTCTTTTTACAGAGTATAC
GGGGGAGCCAGTGCGCACAGCAGAATGTTTCCGTGGCGAT
TTCTACCTGACAGGTGACCGGGGAATGATGGACGATGAAG
GATATTTGTGGTTCATCGGCAGATCTGATGACGTCATCTT
GTCTGCAGGGTACCGTATTGGTCCATTTGAGGTGGAAAAT
GCCCTGATAGAGCATCCAGCTGTAGCTGAATCAGCCGTAG
TCAGCAGCCCTGATCCTGTTCGAGGAGAGGTGGTGAAGGC
TTTTGTTGTGCTGACAGCAGATTTTAAATCAAGAGCCCAT
AAGGAACTGATCAAGGAACTGCAAACACATGTAAAGAGCA
TCACGGCTCCTTACAAATATCCACGCAAGATTGAGTTTGT
GGATCAGCTGCCCAAGACAGTAAGTGGGAAAATAAGACGA
GTGGAGTTAAGAAAGAAGGAATGGGGACAGCAAACCAGCT
AAATCTGGAACTGAGAAATCAAATGTAAAAATGGCATTCC
ACCTCTTCACATGCTACATTCACAAGTGTCTTCCCACATT
TTTTAGAGATGCATGAAGAAGAGATTATTATGAAATGATT
TTCAATATTTCAGCTCGCCAGCAGATGGCAGCACTTCATA
ATGTCTTCATTCAACATATGAACTCACCGGCCACTTTATT
AGGTACTCCTTAGTAGGCTGGACCCTCTTTTGCCTTCAGA
ACTGCCTTAATCCTTTGTGGCATAGATTCAACAGGGTAAT
GGAAAATTCCTCATATTAGATTTTGACATGATAGCGTCAC
ACAGTTGATGCAGATTGTTGGCTGCACATCCATGAAGCGT
ATCTCCCATTCCACCACATCCCAAAGATGCTCTATTGGAT
TGAGGGTCTGGTGACTGTGGAGGCAGTTTGAATACAGTGA
ACTCACGGTCATGTTCAAGAAACCTTCTGAGAGGATCCGC
ATTTATGACATGGTTCGTTATTCTGCTGGAAGTAGCCATC
AGAAGATGGGTACACTGGTCATAAAGATATGGACATGGTC
AGCATCAATACTCAGGTAGGCTGTGGTTTTAACACAATGC
TCAGTGGGTACAAATGGGCCCAAAGCGTGCCAAGAAAATA
TCTCCAACACCATTACACCACCACCACCACCACCAGCCTG
AACCGTTGATACAAGGCAGAATGGATCTATGCTTAATGCT
GTTGATGCCAGATTCTGACCCCACCATCTGATTGTCACAT
AAGAAACCGAGACTCATCACACCAGACAACGTTTTTCCAA
TGTTCTATTGTCGAATTTTAGTGAGCCGGTGAGAATTGTA
ACCTTGTTTCCTTAGCATGCATTGAGTTCCTGCCATGTGA
TTGGCTGATTAGAATTTTTTTAACGAGCAGTTGGACAGGT
GTACCTAATAAAGTGGCTGGTGAGTGTATTTTAACAGCTG
TTAAATTTACTAACCCACATATAATTAATGTTTGTTTTTT
TTACAATCTCTTTATTGTATTTTTTACATCAGTACTAATG
ATAACTTACATGTGTACTTTTTTTCGCTTTTAAACAGTTA
ACAACATGTTACTATTATATGCATAAGAGAACAAAAACAA
AATTATAAAAGTGGAAGGAAGAGGCAAAAAAAAAAGAAAG
GAGGAGAAAAAAAAAGTAAATAAGGGGGGATATTTGAGGC
ATTTCTACTAGGGTTCAATCACTGCTCACTGGTTAAAGTA
CTCAACAAATGTATTCCATATTACATGGAAATTCTTTGTT
TTATTTTTTAGGGAAAGCCTTAGCTTCTCAAGTTGCAGAC
AGGACATGACATTTTTTTTATTAACGTGAAGCAACGTGGA
GGATCTTTTCTATTCCAATTTTTTTAAACTAATCTTCATG
CTAGGGTTATAAATCTGATTACTGTACATTAATTATATGA
TAATTCTGCATCATCACCGACTCCAAATTTAGCTAAAGTA
GGCCCAGGGTATACTTTTTCCTCCACTTCTGATATGAATT
TAAAAACTGAAATCCAATAATTAACAATTTTAGAGCAACT
AAAATTAAACAACACTAAAAACTAAACAAGCGATGCCTGG
GTTTGATTGCATCTATCACACAGTAGGTCTAAGGAAGGGA
ACATCTTAAAATTCATGTTTAAATAGAGTGACGTTATATT
TAGACTTTTATATTGTACATCATATTCTGCACATGCAAAT
CAAAATGATTTCTTTGTTAAAAGAGTAAGCATTCATCACC
ATATTGTTTGGAGTTAATACGTTATTTTATGCGTGTGATT
TTACAATATATAAACTTTGATTTATCAGTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
acsm3-201 Contained in:
[BAC] CH73-60L17 (1)

Genome Resources: Vega_Trans:OTTDART00000039816 (1),  Ensembl_Trans:ENSDART00000041806 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC155584 (1) 3820 bp
CITATIONS (2)