Transcript

col5a1-201

ID
ZDB-TSCRIPT-090929-19946
Name
col5a1-201
Previous Names
  • col5a1-001
  • si:dkey-87m23.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039687 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039687|OTTDARG00000028977|ZDB-GENE-041105-6 col5a1|OTTDARP00000031735 col5a1-001 LG_none FP102966.9,FP102894.6,FP236595.5,CU459135.4 Danio rerio protein_coding NOVEL, 9581 bp
CTGAGCCAGCCGATCTCCTAAAGATTTTAGATTTTCACAG
TTTACCAGACGGTGTAACGAAAACTACAGGATTCTGCACA
CACCGGAAGTCATCGAAAGGGCCTGATGTCGCTTACAGAG
TCACAAAAGATGCACAGCTTAGCGCTCCTACTAAACAACT
GTACCCCTCATCCATGTTTCCGGAGGACTTCTCCATTTTG
GCGACGGTGAGGCCAAAGAAAGGCAGTCAGTCGTTCCTGC
TGTCGGTGTATAATGAGCAGGGCATCCAGCAGCTGGGTTT
GGAAGTGGGACGTTCTCCTGTATTCCTGTATGAGGATCAC
TTAGGCAAACCCGGCCCAGAGGACTACCCGCTCTTCAGAG
GAATCAACCTGGCAGACGGAAAGTGGCACCGTGTAGCGAT
CAGCGTTCACAAACAGAGCATCACTCTGATTTTGGACTGT
AAGAAAAAGGTGACGCGGACACTCTCCAGAAGCCCTCATC
CCATCATCGACACCAAAGGCATTGTGGTCTTCGGAACGCG
GATCCTGGATGAAGAGGTGTTTGAGGGTGACATCCAGCAG
CTGATGATTGTATCGGACCACCGAGCTGCGTTTGACTACT
GTGAGCATTACAGCCCAGACTGTGAGGTTTCTGCACCCGA
ACAGCCCCAGAACCAAGACCCAAACACTGATCAATCTAAC
CCAGAGGAGGATAACTATTATTATGAATATCCCTACTATG
AGGACATGGACTCAGACAAGACTGAAGAAACGATAACTGA
AGAAACCACTGGAACCGAAACCGAAGTGTCTGTTCCGGAC
AGCGGTCGCGTCATCACCTCTGTTATCAGCAGTGGATCAG
GAGGCTCCAGCAGATCATCCAGCGGCTCTTCATCATCCTC
TTCATCATCATCTTCATCATCATCATCCTCCTCATCCTCT
TCCTCCTCCAGCTCCAACACGGCCAATACCGGTGAGGACC
GGTATGATGGATATGATGGATACGATACCGGATATGAAAC
CTATTATGACGAGTCGACCTCAAGTCCTGACGGCTCCCGG
ACCATCACCATCACTAGCACTGGTACTGGATCAGCTGGAG
AATTGGATCTGGGACTAGGAGAAGTGGACCACCAATTGGG
TAGAGTAGATCTGGACAGGCGGATCATCACTTCTTCATCT
TCATCATCTGGAGGAGAAGGAGGTACAGTGCACTCCACCA
CCACCATCATCCGAAACGGAACTTCTGGATCGGGATCCAG
CACCAGAATCATCAGCAGCTCCGGATCTGGATCCAGTTCC
AGGATCAGTATCGGCTCCGGATCCAGCTCTGGGGGCAGTA
CAGGATCCAGTTCCAGCTCCAGTTCCAGCTCTAGTTCCAG
CTCCAGCTCTACCTCAGTTGGTGGAGGCGGCGGTTATGAT
GATGCCCAGTATGGCGAGAGTTATGATCTGTCCTACGGCG
AGGGATACGGAGAAGGATACGGAGAAGGAGATTATACTGT
AGGAGGAGGCAGCAGCAGCTCCAGCACCTCAGTGTCTGTC
GGGGGTGGATCTGTGTCCGTTGGGGGCGGGTCTGTGTCAG
TTGGAGGCGGGTCTGTTTCTGTTGGAGGCGGGTCTGTTTC
TTCAAGTGGCTCCATTGGGGGCGGAACCAGCAGTGCAGGG
GCTGCAGCGGGGGCAGAGTCTGTTGCCACGGGTGGACAGG
GAGGCATCGGTGGAGAAGCAGAATCAATCGATATCGACAA
ATTTAAAGAGGAGTCCATCACGGATTACACCGATGCTGAG
CTGGAAAAGATGTACGATTACGATGATTTGTACACCGATG
GTGATAAAGCACTTCCTGCCGAGACCGATGAAATCTATGG
ACAGGTGGATGGTCTGAGAGGAGAGAAAGGGCAGAAAGGC
GAGCCGGCCATCATTGAACCCGGAATGCTGGTGGAAGGTC
CGTCCGGTCCTGAGGGTCCAACGGGTCTCCCCGGACCTCC
AGGTTCAACAGGACCCCCGGGTAGCGCTGGAGAGCCCGGT
GAGAGGGGTCTTCCTGGTCGTGCTGGTCTGCCTGGAGCTG
ATGGTCTTCCAGGACCTCCAGGGACTGTCCTGATGCTGCC
TTTCCGCATGAGCACAGGAGGAGACGGAGGACAGAAAGGT
CCTGCTGTTTCTGCTCAAGAGGCTCAGATGCAAGCTATCA
TGCAGCAGGCCAGGCTGGCCATGAGGGGACCAACTGGACC
GATGGGTTTGACAGGCCGTCCTGGTCCTCTGGGTCCTCCT
GGTGTGTCTGGATTGAAAGGAGAGTCTGGAGAATCAGGAC
CTCAGGGTCCTCGTGGTCCAATGGGATCTGCAGGCCCTAC
CGGAAAGCCTGGTAGAAGGGGTCGACCCGGCTCAGATGGA
GCCAGAGGGATGCCTGGACAGACAGGACCCAAGGGAGATC
GAGGATTTGATGGTCTCGCTGGTTTGCCCGGTGAAAAGGG
ACACAGGGGTGAGACGGGTCCTCAGGGTCCACCGGGGCCT
TCAGGAGAAGATGGAGAAAGAGGTGACGATGGTGAGGTCG
GTCCCCGAGGCCTGCCTGGTGAACCGGGTCCTCGTGGTGT
TTTGGGCCCCAAAGGTCCTCAAGGGCCTCCAGGACCTCCT
GGTGTGACTGGTATGGACGGACACCCAGGACCTAAAGGAA
ACATTGGTCCTCAAGGTGAACCTGGTCCCCCTGGACAGCA
AGGCAACCCTGGAGCTCAGGGGCTTAATGGTCCTCAGGGA
CCGATCGGACCTCCAGGAGAAAAGGGTCCCACTGGAAAAC
CAGGCTTGCCGGGAATGCCAGGAGCCGACGGGCCTCCGGG
TCACCCAGGGAAAGAAGGGCCATCAGGAGAGAAAGGAAAC
TTGGGACCTCATGGTCCTCAAGGGCCGATTGGTTATCCTG
GGCCTCGAGGTGTGAAGGGTGCTGATGGAGTCCGCGGGCT
GAAAGGAAACAAGGGTGAAAAGGGAGAAGACGGATTCCCG
GGATTTAAGGGAGATATGGGCGTTAAAGGGGACAAGGGAG
AGCTTGGTGCTGCGGGACCCCGAGGTGAAGATGGACCCGA
GGGACCCAAAGGCAGATCTGGTTTGCCTGGAGATCCTGGA
CCACTGGGACCCTTAGGAGAGAAGGGTAAGCTGGGTGTAC
CCGGACTGCCAGGTTATCCAGGCCGGCAAGGACCCAAGGG
CTCTCAAGGATTTCAGGGATTCCAGGGCACCAGTGGAGAG
AAAGGCACTAGGGGGACAGCAGGAAAGCCGGGCCCCCGAG
GACAGAGAGGACCCACGGGACCTCGTGGTGAAAGAGGGCC
GAGGGGACCCACAGGGAAAGCAGGACCAAAGGGCAACTCT
GGAAGCGATGGCCCCCCAGGACCACCCGGTGAACGGGGTC
TGTTGGGACCACAAGGACCAGCTGGATTCCCGGGCCCTAA
GGGTCCACCTGGACCTCCTGGTAAAGATGGACTGCCCGGA
CACCCTGGTCAGAGAGGAGAGACTGGTTTCCAAGGAAAAA
CTGGACCTCCCGGACCTCCAGGTGTAGTCGGACCTCAGGG
ACCAACAGGTGAGACGGGACCAATGGGAGAGCGAGGTCAC
CCTGGACCCCCAGGACCACCTGGTGAACAGGGTCTACCTG
GAGCTGCAGGAAAAGAGGGAGCAAAGGGAGATCCAGGTCC
AGCGGGACCTTCAGGTAAAGACGGACCTCCAGGACTCAGA
GGTTTTCCAGGAGAGAGAGGTTTACCAGGCCCTGTAGGAT
CAGCAGGTTTGAAAGGGAATGAAGGACCCCCGGGGCCTCC
TGGACCCGCTGGTTCTCCTGGTGAACGAGGCCCTGCAGGC
CCAGCTGGTCCTACTGGCATCCCAGGCCGACCTGGACCTC
AAGGACCCCCAGGACCCGCCGGAGAGAAAGGTGGACCGGG
AGAGAAAGGACCTCAAGGCCCAGCTGGTAGAGATGGCATT
CAGGGACCCGTAGGACTTCCAGGCCCAGCCGGACCCATTG
GACCCCCAGGAGAGGATGGTGATAAGGGCGAGATTGGAGA
GCCCGGACAGAAGGGAAGCAAAGGTGACAAGGGTGAACAG
GGTCCTCCAGGGCCAACTGGACCCCAGGGTCCCGCCGGTC
AGCCAGGTCCTTCTGGTGCTGATGGAGAGCCCGGTCCCAG
AGGTCAGCAGGGTCTGTTCGGACAGAAGGGAGATGAAGGT
TCGAGAGGTTTCCCAGGACCACCTGGACCTGTTGGCCTTC
AGGGCTTGCCTGGACCCCCTGGTGAGAAAGGAGAGACTGG
TGACGTCGGTCAGATGGGTCCACCTGGTCCACCAGGCCCC
AGAGGCCCCTCCGGACCCCCAGGAGCAGACGGACCACAGG
GACCTCCAGGAGGCATCGGAAACCCAGGAGCAGTGGGAGA
GAAGGGAGACGCTGGTGAAGCAGGAGAACCAGGCCCTCAG
GGAGACATCGGCCCTCCGGGTCCAAGAGGAGAGCGAGGAG
AAAAGGGAGAAGCTGGACCTGCTGGTTCTGGTGGTCCTCC
TGGACCCAAAGGACCCCCTGGAGATGACGGTCCCAAAGGA
AGTCCGGGCCCAAGTGGTTTCCCTGGTGATCCTGGTCCTC
CCGGAGAGCCAGGTCCTTCTGGTTTGGATGGTTCTCCTGG
TGATAAGGGTGATGATGGAGAGCCTGGTCAGCCAGGATCC
CCTGGACCCACTGGTGAAACTGGTCCTCCTGGCCCTCCAG
GAAAGAGAGGACCTCATGGACCAGCAGGACCTGAAGGAAG
ACAGGGAGAGAAGGGTGCTAAGGGTGAATCTGGTCTGGAG
GGTCCGCCTGGTAAAACAGGTCCAGTTGGTCCTCAAGGAA
GCCCTGGAAAGCCTGGTCCTGAGGGTCTGAGAGGTGTGCC
TGGACCAGTGGGAGAACAAGGACTGCCCGGTGCTCCTGGA
CCCGATGGACCTCCTGGACCGATGGGTCCTCCTGGACTGC
CTGGACTGAAAGGAGATCTTGGTATCAAAGGTGAAAAGGG
TCATCCTGGTCTCATCGGACTTATTGGACCTCCAGGAGAA
CAGGGAGAGAAGGGAGACCGAGGCTTGCCAGGTCCACAGG
GAACTTCAGGACCTAAAGGAGACAATGGTATTGCTGGACC
CTCTGGACCTATCGGACCCATTGGACCTCCTGGACTCCCG
GGTCCTCCTGGTCCTAAAGGAGCTAAAGGATCCAGTGGTC
AGACTGGCCCGAAGGGAGAATCTGGAATACCGGGACCTCC
AGGACCTCCAGGTCCACCAGGTGATGTCATCCACCCTATG
CCTTATCAGTCTTCCCCGAAACGGGCTAAGAGAAACATTG
ATGCCAGCCAGGTGATGGACGAAGCAACAGATGCCAACTA
CAAGGACTACGAAGACGGCATGGAGGAAATATTTGGCTCT
CTCAACTCTCTGAAGCTGGAGATTGAGCAGATGAAACACC
CGCTGGGCACAGAGAGTAACCCCGCACGCACCTGCAAAGA
CCTGCAGCTGTGCCACCCAGACTTCCCAGATGGTGAATAC
TGGATTGATCCCAACCAGGGCTGCTCCAGAGACTCATTCA
AAGTGTACTGTAACTTCACAGCAGGTGGAGAGAGCTGCAT
CTTCCCCGATAAAAAGAGCGAAGGGGCCAGACTCACCTCC
TGGCCGAAGGAGAATCCAGGCACCTGGTTCAGTGAATACA
AACGTGGTAAACTGCTCTCGTATGTGGATGCGGAGGGCAA
TGCCATCGGTGTGGTGCAGATGACGTTCCTGCGTTTGCTC
AGTGCCACGGCCCGGCAGAACCTCACCTACAACTGTTACC
AGTCTGTGGCCTGGCACGACCAAGACCAGGACTCTTACGA
TAAAGCCATCCGCTTCCTGGGCTCCAATGACGAGGAGATG
TCTTACGATAATAACCCGTACATCAGAGCCGTAGTCGACG
GCTGCGCGTTGAAAAAGGGCTATGAAAAGACTATTCTTGA
GATCAACACACCGAAAGTGGAGCAGGTACCGTTTGTTGAC
ATTATGTTCAACGATTTCGGCGGAGCGACGCAGAAGTTCG
GCTTTGAGGTCGGACCAGCCTGCTTCATCGGTTAAGACTG
CTCAAAAACAAAACATATTCATCTTCTCCAAAAAAAAAAC
CAAAACAAAACACAAGAAAGAAATAGGACGACTTATTTGT
AAAGTTTTCGTGTTTCCAAACAAACCCAACCCATACCAAA
GTAAGAAATTTGAAGAAAGAACGGATGTCTAAAACAATGG
GTTCGTAAAGCAACCTTTTTAACCTCAGTGTACCCTCTGC
ATCACATGCAAGTTTTGAAACTGGATGAGGTCATCGCTCG
TGTCTCTCCAAGCCCCGCCCACTTTACTCTTCGCCCCTAC
CACAGGCTGTATAGACAGATTAGATTCCTCTTGGATTTGT
AGCTCAACGCGCGTCCGGTGCTCAGATCGAGAAAGCCTTT
CAGTTGGTTTGTTTGCTTGGGTTTACGTTGTTCCTCTTTC
CACTTTAAGCTTTTGTGCATACTTGTCTTCCATTCCCTGG
AATGGTGATTATATATATAAATATATATAAATATTTTTTT
TCTATGTTTGTAAGTACTTTCTGTATATTTTTTTCTCTTT
GGTGAAGTGTTTTTTTTTTCTGGCTTCAAAACATGCATGT
GAACCCATTGAGCGATAAGGACAGAGCTTCTGGTTATTGG
AATAAACAAAATCAATAAATAAATACATTTCCCTCAAAAA
AATAAAGAACTTTCTGTGAATCTGAGGAAAAGAAAATAAG
GTGCAGCAACAACCAAATGCTTAGAAGATTGCAGATAAGC
CAACGTCTTTTTGTAACAAGATGACAATAAAAGTAGGAAT
CAGCCGTAACATGAGCGTTCATTTGCTAGCTGTCATGTTG
CAGCGGCTGGACTGACGTTGATGAATCAGTGTTTCCCTGT
ATCAGAAGAGCACACCGAGGAAACACAACATTCCCAAACT
AGGTGCTATTTCCTTCTGTCTGTGGTGCTACAAATATATA
TCTTTTTTTTTCCTGAAATTGTTTGTTGTAATTAAATCCA
GCTCTGCAGGTGATGCAAAAGCGGCTCTTCTGTCAAAATA
AAAAGTCCTAGCTTATGCATGACATAAAATCATATTCACT
TATAGATGAGAACAGGTTGTGTTTTTCTTCCTCTTTGACT
ATGTCCTGCTAATTTATGTTCTTCTCAGACTTTACATTAC
AACGTTCATATCACACTCTATTGTCTACTTTATTTGCGGT
GGTTAAACAGAGCACAATTTCTGTTAATGCTGTGGTGATT
TTCTCGTAACAGTGATGGCTGATTTCGACGCACCGCTTCA
TGAAGCTTTGAAACCTTTACGAATCTTTTGTTTCGATTCA
GTGGTTTGGAGTACATTGGTCTTTTCATTTTAATAAATGT
GGCTTCATTAGTTCATTACAGTTTCAAAATGTTTAGAAAA
TTCTATGGTTTTTAGTTTGGGGTCATCTGTGTAACAACAT
AAATTGCTCATGAATCATGCCGGTTCACTTAGATCGCCCT
CAAATTGCGAATCATTGAACAGGTTTCATTGGTTTCACCT
GATCGTAGATCAGTTTTACAAGTCTGTAATGAGGCTTTCG
AATAAAAACGAATAATATTAGTTCATAGTTTAGCACAAAC
AATGGAACAAACAATATATAGCTTGAACATAAAAAACACC
ACAATATTCTGACATTTAATATTTAGTCATGTTAGCATTT
GATTGGTTATACTTTTAATTTGACTACAAAACCAGTCCAA
AATGTAGATTTTTGGAAATTTGAGATTTATACATTAACTA
AAAGTTCAAGATGTATACTTTGGCAGGGTAAAAAAAAAAT
CTTAACTAAAAAATTGCCTTAAAAGTTGTCCAAATTAAAT
CTTTAGCAGTGCACATGGACCCTTTTCACATTTCTGGCTC
TCAGTAGCGGAAGTCGCCATAGTTGGGTAAATTTAGATCG
CAGTAAATGGGAGAGTACAAGTCATTTTACAATCCTATTT
GCTGAAATAATAAAAGAAAAACTCCACGATGGTGTTATAA
AGACTTGCAGAACAAAGAAAAAAAAATAGATAACAGCAGC
CAGAAGAACAACGTTAAATTTACTCTCCTTCACTCAATTG
CCTCCCATAAGCGATAATTTGTCTTTGTAATTTGATGCAA
AGAATATATAATAAATACATTTAAATGTTCATTTGTTTTT
GTTTTTTATCCAAATATTAAAAACTTTCGAGGATTTAAGA
CGCTGATGACTTAAATGACTTGTGAAAAGGGTCTATTACT
AATTGAGTTTGGATATTCACAGTAGTTATATCTTTACAGG
ACATGATCTTGATATTAACCTGAACAGGTTTCATTGAATA
CACCTGATCTCAGATCAGTTTTACATGTTTGTAATGAGAC
TTTAGAATAAAAAACATTATTATTAGTTCACAGTTTAGCA
CAAACAATATACAGCTTGAAAATGTTTTTAAAATGCATAT
TATTCAGGCATTTAAAATTAAATCATATTAGCGTTGGATT
GGTTATACTTTCAATTTGACGTGTTTAAAAAGGCCAATTT
ATTCATATTTTGATGAGCAGTTGCTGTTTTAAACATTTCA
AAACTAAATCATTTTGCGAAGCAACTGGTTCAAAAGTTCA
GAAGCTTTGTAAAGCTTAGTTTCTCCCATCACTAGCGTAG
CATGGATCTGTAAAGCATTACTCTAGTCAAGCTGTAAAAC
TTTTACCATTTCAAACCGCTCTGCGGAATTAGCTTGGGAC
CTTTTGATTTGATCTTTTTTTTTAAAGAGGTATGTGTGAC
GGTATCTGAACCAAAACGCTTAGAGCAATGAATAGTTAAC
TCTAGCATCTTCCTTCCAAAGAGATTTCTCTTAATCCAAG
AGACTTGAAGACCAAGGATCAGATGGTCTTGTGTGATTAT
TCACTAGAAACTTGGCTAGCATTTCTTCCTTCACCTGTCA
GGATTGTTTGTCGTTGACTAGAGCCATCTTGTTGCCACTA
AATGTTTTTCCCTGCACTCTTTTGTTCCGCTTTTGACCAC
TAAACCTGCTACTGCACAATCTTGAGCTCCACTTTTGAAA
ATTAAAGATGACTTGAACTGATTCAACATGGAATTATGCA
GTTTTGACACGATTTCATGATCATACGCAACGAATTTCAA
CCGATTCTTCTGTACATTTTAAAACCAGCAGTGATGCTGC
CAATAAAGTTGATTCTGTTTTGTTTTTTCGTCTTTGTAAT
GTTTGTTTGTTTGTTATTTTGCGCTCGTGTCGAACCTGTG
TACAAGCAGATAGAAGAGATTTGTGTCAATAAATTGGAGT
TTACTGTGTCCACCCACCCTTGTATGTCTTTTGAAGCATT
AAAACTTTCCTGTATGCATGAAATTGTTAAGCTTTCTCTT
GATGTTTCTTCCCACAGCCACATTCTTTTTTGACTGTTTT
TTCTTTTTAATCGGCGCTCTGAAACGTCCTCACAGTGCTC
GGATGAAAACAGGCCTGTCCTTCATTGTGAAATGGAGAGA
GAGAGAGCGATGTCTGTTGTAACTCTCTACCAAAGCCCAT
GTTCCTTTGTAGTATATTTATTGTATTATTTAAAAATAAT
AAATGTTAATTGATACCAGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations